Incidental Mutation 'R1065:Ints4'
List |< first << previous [record 11 of 36] next >> last >|
ID85965
Institutional Source Beutler Lab
Gene Symbol Ints4
Ensembl Gene ENSMUSG00000025133
Gene Nameintegrator complex subunit 4
Synonyms2610034N24Rik
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97480956-97541395 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 97507892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026126] [ENSMUST00000026126] [ENSMUST00000026126] [ENSMUST00000026126]
Predicted Effect probably null
Transcript: ENSMUST00000026126
SMART Domains Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133

DomainStartEndE-ValueType
Pfam:HEAT_2 153 258 9.8e-9 PFAM
Pfam:Cohesin_HEAT 179 219 7.7e-6 PFAM
low complexity region 518 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026126
SMART Domains Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133

DomainStartEndE-ValueType
Pfam:HEAT_2 153 258 9.8e-9 PFAM
Pfam:Cohesin_HEAT 179 219 7.7e-6 PFAM
low complexity region 518 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026126
SMART Domains Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133

DomainStartEndE-ValueType
Pfam:HEAT_2 153 258 9.8e-9 PFAM
Pfam:Cohesin_HEAT 179 219 7.7e-6 PFAM
low complexity region 518 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026126
SMART Domains Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133

DomainStartEndE-ValueType
Pfam:HEAT_2 153 258 9.8e-9 PFAM
Pfam:Cohesin_HEAT 179 219 7.7e-6 PFAM
low complexity region 518 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206644
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS4 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Ints4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Ints4 APN 7 97535205 missense probably damaging 1.00
IGL01736:Ints4 APN 7 97526642 missense probably benign 0.01
IGL01862:Ints4 APN 7 97541153 missense probably damaging 1.00
IGL02277:Ints4 APN 7 97487458 missense probably damaging 1.00
IGL02396:Ints4 APN 7 97537900 missense possibly damaging 0.64
IGL02661:Ints4 APN 7 97495705 missense probably benign
IGL02750:Ints4 APN 7 97517757 critical splice donor site probably null
IGL03108:Ints4 APN 7 97490930 critical splice acceptor site probably null
R0332:Ints4 UTSW 7 97517718 missense probably damaging 1.00
R0449:Ints4 UTSW 7 97529223 missense probably damaging 0.97
R1722:Ints4 UTSW 7 97513579 missense probably benign 0.24
R2060:Ints4 UTSW 7 97501763 missense possibly damaging 0.93
R2211:Ints4 UTSW 7 97509750 missense possibly damaging 0.63
R3731:Ints4 UTSW 7 97506101 missense probably benign 0.18
R3881:Ints4 UTSW 7 97516257 missense possibly damaging 0.94
R4089:Ints4 UTSW 7 97529255 nonsense probably null
R4192:Ints4 UTSW 7 97507733 missense probably damaging 1.00
R4479:Ints4 UTSW 7 97484971 missense probably damaging 1.00
R4980:Ints4 UTSW 7 97501850 critical splice donor site probably null
R5029:Ints4 UTSW 7 97509774 missense probably benign 0.06
R5306:Ints4 UTSW 7 97509678 missense probably damaging 1.00
R6160:Ints4 UTSW 7 97509583 splice site probably null
R6317:Ints4 UTSW 7 97529218 nonsense probably null
R6961:Ints4 UTSW 7 97541190 makesense probably null
R7026:Ints4 UTSW 7 97519154 missense possibly damaging 0.50
R7156:Ints4 UTSW 7 97535286 critical splice donor site probably null
R7205:Ints4 UTSW 7 97535226 nonsense probably null
R7234:Ints4 UTSW 7 97530300 missense probably benign 0.00
R7418:Ints4 UTSW 7 97490972 missense probably benign 0.03
R7423:Ints4 UTSW 7 97507719 missense probably damaging 1.00
R7462:Ints4 UTSW 7 97506128 missense probably benign 0.11
R7658:Ints4 UTSW 7 97529253 missense possibly damaging 0.90
R7947:Ints4 UTSW 7 97499585 missense probably benign
R8114:Ints4 UTSW 7 97516525 splice site probably null
R8426:Ints4 UTSW 7 97501032 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAAACGCACTGCACATGAGC -3'
(R):5'- GGACCTTAGCCTCTCCTTCATAGTAGG -3'

Sequencing Primer
(F):5'- GCGTGCCAAGGAACTTTAC -3'
(R):5'- agggcacacgagtggag -3'
Posted On2013-11-18