Mutagenetix > Incidental Mutation

Incidental Mutation 'R1065:Smarca5'

85967

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

039151-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1065 (G1)

Quality Score

159

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80704714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 958 (L958Q)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: L958Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: L958Q

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122807

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142470

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	A	G	6: 129,323,050	I155T	possibly damaging	Het
Cd300ld2	T	C	11: 115,013,760	T94A	probably damaging	Het
Cdc42bpg	G	A	19: 6,322,826	S1515N	probably damaging	Het
Ckb	T	C	12: 111,671,247	E150G	probably benign	Het
Cobl	T	A	11: 12,254,327	M785L	possibly damaging	Het
Col6a5	T	C	9: 105,881,783	N2075D	probably damaging	Het
Commd7	G	C	2: 153,619,527		probably benign	Het
Corin	G	A	5: 72,301,650	R927*	probably null	Het
Ift122	A	T	6: 115,875,325		probably null	Het
Il1b	G	A	2: 129,368,007	T83I	probably benign	Het
Ints4	T	C	7: 97,507,892		probably null	Het
Msh6	T	G	17: 87,988,463		probably benign	Het
Mtmr3	T	C	11: 4,492,859	K392E	probably damaging	Het
Olfr1094	A	G	2: 86,829,544	H264R	probably damaging	Het
Pde3a	T	C	6: 141,476,732		probably benign	Het
Pde6h	A	C	6: 136,959,370	K37T	probably damaging	Het
Plat	C	A	8: 22,776,863	D290E	probably damaging	Het
Polk	A	C	13: 96,508,252	L122R	probably damaging	Het
Ppp1r3g	T	A	13: 35,969,435	D279E	probably benign	Het
Ptpru	T	C	4: 131,808,340	E370G	possibly damaging	Het
Ralgapa2	T	C	2: 146,450,558	Y187C	probably benign	Het
Rps6ka2	C	T	17: 7,281,758		probably benign	Het
Slit3	T	C	11: 35,121,635	S41P	possibly damaging	Het
Snx9	T	C	17: 5,902,361		probably benign	Het
Stkld1	A	T	2: 26,940,038	N72I	probably damaging	Het
Strc	C	A	2: 121,366,651	D1532Y	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Svil	T	G	18: 5,063,777		probably benign	Het
Traf3ip1	T	A	1: 91,500,784	D122E	unknown	Het
Vmn2r7	A	T	3: 64,707,138	D509E	possibly damaging	Het
Vps52	C	A	17: 33,961,239	Q306K	probably benign	Het
Wdr60	C	T	12: 116,256,076	R82H	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp418	C	A	7: 7,181,562	Q175K	probably benign	Het
Zxdc	T	C	6: 90,378,903	S465P	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGATGAGCAGACAGATGCCTGAAG -3'
(R):5'- GTTAGCCTGGTTTAAAGAAGACCCCAC -3'

Sequencing Primer
(F):5'- AGAGCTGTCTACTTGCAAACTC -3'
(R):5'- GAAGACCCCACTTCTTAAGTGTTAG -3'

Posted On

2013-11-18