Mutagenetix > Incidental Mutations

Incidental Mutation 'R1065:Cobl'

85970

Institutional Source

Beutler Lab

Gene Symbol

Cobl

Ensembl Gene

ENSMUSG00000020173

Gene Name

cordon-bleu WH2 repeat

Synonyms

C530045F18Rik

MMRRC Submission

039151-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1065 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12236608-12464960 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12254327 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 785 (M785L)

Ref Sequence

ENSEMBL: ENSMUSP00000133470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046755
AA Change: M792L

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: M792L

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	144	235	2.2e-46	PFAM
low complexity region	328	333	N/A	INTRINSIC
low complexity region	360	376	N/A	INTRINSIC
low complexity region	408	433	N/A	INTRINSIC
low complexity region	468	482	N/A	INTRINSIC
low complexity region	526	541	N/A	INTRINSIC
coiled coil region	564	589	N/A	INTRINSIC
WH2	1185	1205	1.32e0	SMART
WH2	1225	1245	6.36e-3	SMART
low complexity region	1276	1296	N/A	INTRINSIC
WH2	1313	1333	3.91e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109650
AA Change: M710L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: M710L

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	1.6e-40	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	444	459	N/A	INTRINSIC
coiled coil region	482	507	N/A	INTRINSIC
WH2	1103	1123	1.32e0	SMART
WH2	1143	1163	6.36e-3	SMART
low complexity region	1194	1214	N/A	INTRINSIC
WH2	1231	1251	3.91e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109651
AA Change: M767L

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: M767L

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	1.2e-40	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC
low complexity region	383	408	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
coiled coil region	539	564	N/A	INTRINSIC
WH2	1160	1180	1.32e0	SMART
WH2	1200	1220	6.36e-3	SMART
low complexity region	1251	1271	N/A	INTRINSIC
WH2	1288	1308	3.91e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172919

SMART Domains

Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	2.6e-41	PFAM
low complexity region	328	333	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172956

SMART Domains

Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	2.4e-41	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174874
AA Change: M785L

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: M785L

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
Pfam:Cobl	175	253	1.2e-40	PFAM
low complexity region	321	326	N/A	INTRINSIC
low complexity region	353	369	N/A	INTRINSIC
low complexity region	401	426	N/A	INTRINSIC
low complexity region	461	475	N/A	INTRINSIC
low complexity region	519	534	N/A	INTRINSIC
coiled coil region	557	582	N/A	INTRINSIC
WH2	1178	1198	1.32e0	SMART
WH2	1218	1238	6.36e-3	SMART
low complexity region	1269	1289	N/A	INTRINSIC
WH2	1306	1326	3.91e-3	SMART

Meta Mutation Damage Score

0.1157

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	A	G	6: 129,323,050	I155T	possibly damaging	Het
Cd300ld2	T	C	11: 115,013,760	T94A	probably damaging	Het
Cdc42bpg	G	A	19: 6,322,826	S1515N	probably damaging	Het
Ckb	T	C	12: 111,671,247	E150G	probably benign	Het
Col6a5	T	C	9: 105,881,783	N2075D	probably damaging	Het
Commd7	G	C	2: 153,619,527		probably benign	Het
Corin	G	A	5: 72,301,650	R927*	probably null	Het
Ift122	A	T	6: 115,875,325		probably null	Het
Il1b	G	A	2: 129,368,007	T83I	probably benign	Het
Ints4	T	C	7: 97,507,892		probably null	Het
Msh6	T	G	17: 87,988,463		probably benign	Het
Mtmr3	T	C	11: 4,492,859	K392E	probably damaging	Het
Olfr1094	A	G	2: 86,829,544	H264R	probably damaging	Het
Pde3a	T	C	6: 141,476,732		probably benign	Het
Pde6h	A	C	6: 136,959,370	K37T	probably damaging	Het
Plat	C	A	8: 22,776,863	D290E	probably damaging	Het
Polk	A	C	13: 96,508,252	L122R	probably damaging	Het
Ppp1r3g	T	A	13: 35,969,435	D279E	probably benign	Het
Ptpru	T	C	4: 131,808,340	E370G	possibly damaging	Het
Ralgapa2	T	C	2: 146,450,558	Y187C	probably benign	Het
Rps6ka2	C	T	17: 7,281,758		probably benign	Het
Slit3	T	C	11: 35,121,635	S41P	possibly damaging	Het
Smarca5	A	T	8: 80,704,714	L958Q	probably damaging	Het
Snx9	T	C	17: 5,902,361		probably benign	Het
Stkld1	A	T	2: 26,940,038	N72I	probably damaging	Het
Strc	C	A	2: 121,366,651	D1532Y	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Svil	T	G	18: 5,063,777		probably benign	Het
Traf3ip1	T	A	1: 91,500,784	D122E	unknown	Het
Vmn2r7	A	T	3: 64,707,138	D509E	possibly damaging	Het
Vps52	C	A	17: 33,961,239	Q306K	probably benign	Het
Wdr60	C	T	12: 116,256,076	R82H	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp418	C	A	7: 7,181,562	Q175K	probably benign	Het
Zxdc	T	C	6: 90,378,903	S465P	probably damaging	Het

Other mutations in Cobl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Cobl	APN	11	12375813	missense	possibly damaging	0.89
IGL00698:Cobl	APN	11	12253722	missense	probably benign	0.41
IGL00772:Cobl	APN	11	12266985	missense	probably benign	0.02
IGL00922:Cobl	APN	11	12254866	missense	probably damaging	1.00
IGL00985:Cobl	APN	11	12254843	missense	probably damaging	1.00
IGL01641:Cobl	APN	11	12309641	nonsense	probably null
IGL01722:Cobl	APN	11	12253987	missense	probably benign	0.00
IGL01734:Cobl	APN	11	12254980	splice site	probably benign
IGL01924:Cobl	APN	11	12254596	missense	probably benign	0.30
IGL02105:Cobl	APN	11	12249651	missense	probably damaging	1.00
IGL02326:Cobl	APN	11	12386712	missense	possibly damaging	0.69
IGL02342:Cobl	APN	11	12253672	missense	possibly damaging	0.64
IGL02426:Cobl	APN	11	12254351	nonsense	probably null
IGL02754:Cobl	APN	11	12254371	missense	probably damaging	1.00
IGL02754:Cobl	APN	11	12254370	missense	probably damaging	1.00
IGL02811:Cobl	APN	11	12253285	missense	possibly damaging	0.56
IGL02859:Cobl	APN	11	12369602	missense	probably damaging	1.00
IGL02999:Cobl	APN	11	12343869	missense	possibly damaging	0.71
IGL03030:Cobl	APN	11	12254241	missense	possibly damaging	0.80
IGL03191:Cobl	APN	11	12253364	missense	probably benign	0.00
PIT4418001:Cobl	UTSW	11	12256240	missense	possibly damaging	0.79
PIT4480001:Cobl	UTSW	11	12253592	missense	probably benign
PIT4495001:Cobl	UTSW	11	12254596	missense	probably benign	0.00
R0031:Cobl	UTSW	11	12254945	missense	probably benign	0.36
R0241:Cobl	UTSW	11	12254524	missense	probably benign	0.25
R0241:Cobl	UTSW	11	12254524	missense	probably benign	0.25
R0322:Cobl	UTSW	11	12267072	missense	probably damaging	1.00
R0597:Cobl	UTSW	11	12254699	missense	probably benign	0.24
R0733:Cobl	UTSW	11	12365167	missense	probably benign	0.31
R0734:Cobl	UTSW	11	12375971	missense	probably damaging	1.00
R0784:Cobl	UTSW	11	12266843	splice site	probably benign
R0884:Cobl	UTSW	11	12375908	missense	possibly damaging	0.89
R1331:Cobl	UTSW	11	12375853	missense	probably damaging	0.96
R1892:Cobl	UTSW	11	12253258	missense	probably damaging	0.99
R2847:Cobl	UTSW	11	12378342	missense	probably damaging	1.00
R2848:Cobl	UTSW	11	12378342	missense	probably damaging	1.00
R3407:Cobl	UTSW	11	12375830	missense	probably damaging	1.00
R4627:Cobl	UTSW	11	12251093	missense	probably damaging	1.00
R4662:Cobl	UTSW	11	12253672	missense	probably benign	0.08
R4677:Cobl	UTSW	11	12386665	missense	possibly damaging	0.93
R4844:Cobl	UTSW	11	12254740	missense	probably benign	0.10
R4942:Cobl	UTSW	11	12254185	missense	probably damaging	0.99
R5158:Cobl	UTSW	11	12256198	missense	possibly damaging	0.84
R5195:Cobl	UTSW	11	12253565	missense	probably benign	0.02
R5255:Cobl	UTSW	11	12375825	missense	probably damaging	1.00
R5588:Cobl	UTSW	11	12343886	nonsense	probably null
R5637:Cobl	UTSW	11	12296531	intron	probably benign
R5643:Cobl	UTSW	11	12306948	splice site	probably benign
R5749:Cobl	UTSW	11	12266965	missense	possibly damaging	0.86
R5953:Cobl	UTSW	11	12256220	missense	probably benign	0.00
R6000:Cobl	UTSW	11	12369684	missense	probably benign	0.08
R6373:Cobl	UTSW	11	12253118	missense	probably damaging	1.00
R7034:Cobl	UTSW	11	12254177	missense	probably damaging	1.00
R7071:Cobl	UTSW	11	12254795	missense	probably benign	0.00
R7077:Cobl	UTSW	11	12253441	missense	probably benign	0.04
R7078:Cobl	UTSW	11	12378271	missense	probably damaging	1.00
R7099:Cobl	UTSW	11	12296540	missense
R7153:Cobl	UTSW	11	12254128	missense	probably damaging	1.00
R7448:Cobl	UTSW	11	12256225	missense	possibly damaging	0.46
R7519:Cobl	UTSW	11	12253124	missense	probably damaging	1.00
R7767:Cobl	UTSW	11	12412117	start gained	probably benign
R7772:Cobl	UTSW	11	12254488	missense	probably benign	0.29
R7841:Cobl	UTSW	11	12253324	missense	probably damaging	1.00
R7845:Cobl	UTSW	11	12365139	missense	probably benign	0.35
R7924:Cobl	UTSW	11	12253324	missense	probably damaging	1.00
R7928:Cobl	UTSW	11	12365139	missense	probably benign	0.35
R8026:Cobl	UTSW	11	12253459	missense	probably benign	0.01
Z1176:Cobl	UTSW	11	12253433	missense	probably benign	0.02
Z1176:Cobl	UTSW	11	12369645	missense	probably damaging	1.00
Z1176:Cobl	UTSW	11	12375827	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGCCTCCAGAACTCTTTGAC -3'
(R):5'- GCCAGCCATTCGTAAGGACAAGTAG -3'

Sequencing Primer
(F):5'- ACTCTTTGACTTTTCCAATAGGTGG -3'
(R):5'- GCAAAGTGCATGGTTCTAGTCAC -3'

Posted On

2013-11-18