Incidental Mutation 'R1065:Cd300ld2'
ID85972
Institutional Source Beutler Lab
Gene Symbol Cd300ld2
Ensembl Gene ENSMUSG00000089753
Gene NameCD300 molecule like family member D2
SynonymsGm11709
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115010335-115016193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115013760 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 94 (T94A)
Ref Sequence ENSEMBL: ENSMUSP00000102188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092463] [ENSMUST00000106578]
Predicted Effect probably damaging
Transcript: ENSMUST00000092463
AA Change: T94A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090120
Gene: ENSMUSG00000089753
AA Change: T94A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106578
AA Change: T94A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102188
Gene: ENSMUSG00000089753
AA Change: T94A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
low complexity region 131 201 N/A INTRINSIC
low complexity region 202 222 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Cd300ld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Cd300ld2 APN 11 115012297 missense probably benign 0.23
IGL01450:Cd300ld2 APN 11 115012543 unclassified probably benign
IGL01452:Cd300ld2 APN 11 115012602 unclassified probably benign
IGL02086:Cd300ld2 APN 11 115012558 unclassified probably benign
IGL02111:Cd300ld2 APN 11 115012393 unclassified probably benign
IGL02505:Cd300ld2 APN 11 115013687 missense probably benign 0.11
IGL02517:Cd300ld2 APN 11 115010423 missense possibly damaging 0.53
IGL02836:Cd300ld2 APN 11 115013750 missense probably benign 0.07
IGL03081:Cd300ld2 APN 11 115012542 unclassified probably benign
PIT4486001:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R0579:Cd300ld2 UTSW 11 115012299 missense probably benign 0.23
R1393:Cd300ld2 UTSW 11 115012578 unclassified probably benign
R1481:Cd300ld2 UTSW 11 115012633 missense probably benign 0.36
R1583:Cd300ld2 UTSW 11 115013777 missense probably benign 0.06
R1755:Cd300ld2 UTSW 11 115013775 missense probably benign 0.01
R1865:Cd300ld2 UTSW 11 115012618 unclassified probably benign
R4018:Cd300ld2 UTSW 11 115012504 unclassified probably benign
R5516:Cd300ld2 UTSW 11 115012444 unclassified probably benign
R6065:Cd300ld2 UTSW 11 115012602 unclassified probably benign
R6927:Cd300ld2 UTSW 11 115013793 missense probably damaging 1.00
R7874:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R7883:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R8044:Cd300ld2 UTSW 11 115013719 nonsense probably null
R8263:Cd300ld2 UTSW 11 115012366 missense unknown
R8306:Cd300ld2 UTSW 11 115013822 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCCTCTTTCTTGGCAGGACAAATAC -3'
(R):5'- TTCAGCTCATGAACTCTACTTGGCAC -3'

Sequencing Primer
(F):5'- CTTTCTTGGCAGGACAAATACAGTAG -3'
(R):5'- ACTTGGCACAGTAGAGTTTCC -3'
Posted On2013-11-18