Incidental Mutation 'R1065:Wdr60'
ID 85974
Institutional Source Beutler Lab
Gene Symbol Wdr60
Ensembl Gene ENSMUSG00000042050
Gene Name WD repeat domain 60
Synonyms D430033N04Rik
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1065 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 116206262-116263022 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 116256076 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 82 (R82H)
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349] [ENSMUST00000222679]
AlphaFold Q8C761
Predicted Effect probably damaging
Transcript: ENSMUST00000039349
AA Change: R82H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: R82H

coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221029
Predicted Effect probably benign
Transcript: ENSMUST00000222679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223039
Meta Mutation Damage Score 0.1193 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Wdr60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Wdr60 APN 12 116241780 missense probably benign 0.01
IGL00668:Wdr60 APN 12 116257428 missense probably benign 0.32
IGL00914:Wdr60 APN 12 116232603 missense probably damaging 1.00
IGL01061:Wdr60 APN 12 116229704 missense probably benign 0.45
IGL01375:Wdr60 APN 12 116229676 missense possibly damaging 0.91
IGL01758:Wdr60 APN 12 116218798 missense possibly damaging 0.82
IGL01930:Wdr60 APN 12 116225963 critical splice donor site probably null
IGL02028:Wdr60 APN 12 116256061 missense probably benign 0.06
IGL03180:Wdr60 APN 12 116218865 missense probably benign 0.07
F5770:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
R0153:Wdr60 UTSW 12 116232636 missense probably benign 0.01
R0265:Wdr60 UTSW 12 116257406 splice site probably benign
R0364:Wdr60 UTSW 12 116257477 splice site probably benign
R0601:Wdr60 UTSW 12 116255935 missense possibly damaging 0.79
R0624:Wdr60 UTSW 12 116248290 missense probably damaging 0.98
R0755:Wdr60 UTSW 12 116211792 missense probably benign 0.01
R1023:Wdr60 UTSW 12 116232657 missense probably damaging 1.00
R1543:Wdr60 UTSW 12 116231784 splice site probably benign
R1663:Wdr60 UTSW 12 116229610 missense probably benign 0.01
R1678:Wdr60 UTSW 12 116225970 missense probably damaging 1.00
R1719:Wdr60 UTSW 12 116255912 missense probably benign
R1755:Wdr60 UTSW 12 116226029 missense probably damaging 0.98
R1832:Wdr60 UTSW 12 116207743 missense probably damaging 0.99
R1918:Wdr60 UTSW 12 116232601 missense probably damaging 0.96
R2291:Wdr60 UTSW 12 116229571 splice site probably null
R2444:Wdr60 UTSW 12 116232669 missense possibly damaging 0.93
R3419:Wdr60 UTSW 12 116224977 missense probably benign 0.05
R3699:Wdr60 UTSW 12 116211842 nonsense probably null
R3700:Wdr60 UTSW 12 116211842 nonsense probably null
R4445:Wdr60 UTSW 12 116207715 missense probably damaging 1.00
R4664:Wdr60 UTSW 12 116256211 missense probably damaging 0.99
R4954:Wdr60 UTSW 12 116256025 missense probably damaging 1.00
R5057:Wdr60 UTSW 12 116213413 missense probably benign 0.43
R5163:Wdr60 UTSW 12 116255866 missense possibly damaging 0.76
R5341:Wdr60 UTSW 12 116255914 missense possibly damaging 0.51
R5560:Wdr60 UTSW 12 116218113 missense probably damaging 0.98
R5870:Wdr60 UTSW 12 116256245 missense possibly damaging 0.94
R5925:Wdr60 UTSW 12 116233394 missense possibly damaging 0.82
R6223:Wdr60 UTSW 12 116257458 missense possibly damaging 0.95
R6364:Wdr60 UTSW 12 116241732 missense probably damaging 1.00
R6450:Wdr60 UTSW 12 116246727 nonsense probably null
R6462:Wdr60 UTSW 12 116229631 missense probably benign
R6751:Wdr60 UTSW 12 116213456 missense possibly damaging 0.52
R6896:Wdr60 UTSW 12 116229671 missense possibly damaging 0.52
R6962:Wdr60 UTSW 12 116211778 missense probably damaging 1.00
R7033:Wdr60 UTSW 12 116211891 missense probably benign 0.03
R7042:Wdr60 UTSW 12 116254441 missense probably benign 0.02
R7254:Wdr60 UTSW 12 116262585 intron probably benign
R7567:Wdr60 UTSW 12 116254510 splice site probably null
R7889:Wdr60 UTSW 12 116255939 nonsense probably null
R8082:Wdr60 UTSW 12 116213507 critical splice acceptor site probably null
R8288:Wdr60 UTSW 12 116213725 missense probably damaging 1.00
R8309:Wdr60 UTSW 12 116256085 missense probably damaging 1.00
R8682:Wdr60 UTSW 12 116224990 missense probably damaging 1.00
R8683:Wdr60 UTSW 12 116229642 missense probably benign 0.03
R8699:Wdr60 UTSW 12 116207701 missense probably benign 0.01
R8782:Wdr60 UTSW 12 116241712 missense probably damaging 1.00
R8809:Wdr60 UTSW 12 116229614 missense probably damaging 0.98
R9281:Wdr60 UTSW 12 116248057 nonsense probably null
V7581:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7582:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7583:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
X0063:Wdr60 UTSW 12 116255869 missense probably benign
Z1177:Wdr60 UTSW 12 116246099 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctctgcttcttggtctcgat -3'
Posted On 2013-11-18