Mutagenetix > Incidental Mutation

Incidental Mutation 'R1065:Wdr60'

85974

Institutional Source

Beutler Lab

Gene Symbol

Wdr60

Ensembl Gene

ENSMUSG00000042050

Gene Name

WD repeat domain 60

Synonyms

D430033N04Rik

MMRRC Submission

039151-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1065 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116206262-116263022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 116256076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 82 (R82H)

Ref Sequence

ENSEMBL: ENSMUSP00000047334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039349] [ENSMUST00000222679]

AlphaFold

Q8C761

Predicted Effect

probably damaging
Transcript: ENSMUST00000039349
AA Change: R82H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: R82H

Domain	Start	End	E-Value	Type
coiled coil region	84	122	N/A	INTRINSIC
low complexity region	168	193	N/A	INTRINSIC
low complexity region	226	242	N/A	INTRINSIC
coiled coil region	280	309	N/A	INTRINSIC
low complexity region	319	337	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
WD40	629	668	2.77e-1	SMART
Blast:WD40	694	755	2e-7	BLAST
WD40	846	881	3.84e0	SMART
WD40	884	926	5.55e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221029

Predicted Effect

probably benign
Transcript: ENSMUST00000222679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223039

Meta Mutation Damage Score

0.1193

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	A	G	6: 129,323,050	I155T	possibly damaging	Het
Cd300ld2	T	C	11: 115,013,760	T94A	probably damaging	Het
Cdc42bpg	G	A	19: 6,322,826	S1515N	probably damaging	Het
Ckb	T	C	12: 111,671,247	E150G	probably benign	Het
Cobl	T	A	11: 12,254,327	M785L	possibly damaging	Het
Col6a5	T	C	9: 105,881,783	N2075D	probably damaging	Het
Commd7	G	C	2: 153,619,527		probably benign	Het
Corin	G	A	5: 72,301,650	R927*	probably null	Het
Ift122	A	T	6: 115,875,325		probably null	Het
Il1b	G	A	2: 129,368,007	T83I	probably benign	Het
Ints4	T	C	7: 97,507,892		probably null	Het
Msh6	T	G	17: 87,988,463		probably benign	Het
Mtmr3	T	C	11: 4,492,859	K392E	probably damaging	Het
Olfr1094	A	G	2: 86,829,544	H264R	probably damaging	Het
Pde3a	T	C	6: 141,476,732		probably benign	Het
Pde6h	A	C	6: 136,959,370	K37T	probably damaging	Het
Plat	C	A	8: 22,776,863	D290E	probably damaging	Het
Polk	A	C	13: 96,508,252	L122R	probably damaging	Het
Ppp1r3g	T	A	13: 35,969,435	D279E	probably benign	Het
Ptpru	T	C	4: 131,808,340	E370G	possibly damaging	Het
Ralgapa2	T	C	2: 146,450,558	Y187C	probably benign	Het
Rps6ka2	C	T	17: 7,281,758		probably benign	Het
Slit3	T	C	11: 35,121,635	S41P	possibly damaging	Het
Smarca5	A	T	8: 80,704,714	L958Q	probably damaging	Het
Snx9	T	C	17: 5,902,361		probably benign	Het
Stkld1	A	T	2: 26,940,038	N72I	probably damaging	Het
Strc	C	A	2: 121,366,651	D1532Y	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Svil	T	G	18: 5,063,777		probably benign	Het
Traf3ip1	T	A	1: 91,500,784	D122E	unknown	Het
Vmn2r7	A	T	3: 64,707,138	D509E	possibly damaging	Het
Vps52	C	A	17: 33,961,239	Q306K	probably benign	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp418	C	A	7: 7,181,562	Q175K	probably benign	Het
Zxdc	T	C	6: 90,378,903	S465P	probably damaging	Het

Other mutations in Wdr60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Wdr60	APN	12	116241780	missense	probably benign	0.01
IGL00668:Wdr60	APN	12	116257428	missense	probably benign	0.32
IGL00914:Wdr60	APN	12	116232603	missense	probably damaging	1.00
IGL01061:Wdr60	APN	12	116229704	missense	probably benign	0.45
IGL01375:Wdr60	APN	12	116229676	missense	possibly damaging	0.91
IGL01758:Wdr60	APN	12	116218798	missense	possibly damaging	0.82
IGL01930:Wdr60	APN	12	116225963	critical splice donor site	probably null
IGL02028:Wdr60	APN	12	116256061	missense	probably benign	0.06
IGL03180:Wdr60	APN	12	116218865	missense	probably benign	0.07
F5770:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
R0153:Wdr60	UTSW	12	116232636	missense	probably benign	0.01
R0265:Wdr60	UTSW	12	116257406	splice site	probably benign
R0364:Wdr60	UTSW	12	116257477	splice site	probably benign
R0601:Wdr60	UTSW	12	116255935	missense	possibly damaging	0.79
R0624:Wdr60	UTSW	12	116248290	missense	probably damaging	0.98
R0755:Wdr60	UTSW	12	116211792	missense	probably benign	0.01
R1023:Wdr60	UTSW	12	116232657	missense	probably damaging	1.00
R1543:Wdr60	UTSW	12	116231784	splice site	probably benign
R1663:Wdr60	UTSW	12	116229610	missense	probably benign	0.01
R1678:Wdr60	UTSW	12	116225970	missense	probably damaging	1.00
R1719:Wdr60	UTSW	12	116255912	missense	probably benign
R1755:Wdr60	UTSW	12	116226029	missense	probably damaging	0.98
R1832:Wdr60	UTSW	12	116207743	missense	probably damaging	0.99
R1918:Wdr60	UTSW	12	116232601	missense	probably damaging	0.96
R2291:Wdr60	UTSW	12	116229571	splice site	probably null
R2444:Wdr60	UTSW	12	116232669	missense	possibly damaging	0.93
R3419:Wdr60	UTSW	12	116224977	missense	probably benign	0.05
R3699:Wdr60	UTSW	12	116211842	nonsense	probably null
R3700:Wdr60	UTSW	12	116211842	nonsense	probably null
R4445:Wdr60	UTSW	12	116207715	missense	probably damaging	1.00
R4664:Wdr60	UTSW	12	116256211	missense	probably damaging	0.99
R4954:Wdr60	UTSW	12	116256025	missense	probably damaging	1.00
R5057:Wdr60	UTSW	12	116213413	missense	probably benign	0.43
R5163:Wdr60	UTSW	12	116255866	missense	possibly damaging	0.76
R5341:Wdr60	UTSW	12	116255914	missense	possibly damaging	0.51
R5560:Wdr60	UTSW	12	116218113	missense	probably damaging	0.98
R5870:Wdr60	UTSW	12	116256245	missense	possibly damaging	0.94
R5925:Wdr60	UTSW	12	116233394	missense	possibly damaging	0.82
R6223:Wdr60	UTSW	12	116257458	missense	possibly damaging	0.95
R6364:Wdr60	UTSW	12	116241732	missense	probably damaging	1.00
R6450:Wdr60	UTSW	12	116246727	nonsense	probably null
R6462:Wdr60	UTSW	12	116229631	missense	probably benign
R6751:Wdr60	UTSW	12	116213456	missense	possibly damaging	0.52
R6896:Wdr60	UTSW	12	116229671	missense	possibly damaging	0.52
R6962:Wdr60	UTSW	12	116211778	missense	probably damaging	1.00
R7033:Wdr60	UTSW	12	116211891	missense	probably benign	0.03
R7042:Wdr60	UTSW	12	116254441	missense	probably benign	0.02
R7254:Wdr60	UTSW	12	116262585	intron	probably benign
R7567:Wdr60	UTSW	12	116254510	splice site	probably null
R7889:Wdr60	UTSW	12	116255939	nonsense	probably null
R8082:Wdr60	UTSW	12	116213507	critical splice acceptor site	probably null
R8288:Wdr60	UTSW	12	116213725	missense	probably damaging	1.00
R8309:Wdr60	UTSW	12	116256085	missense	probably damaging	1.00
R8682:Wdr60	UTSW	12	116224990	missense	probably damaging	1.00
R8683:Wdr60	UTSW	12	116229642	missense	probably benign	0.03
R8699:Wdr60	UTSW	12	116207701	missense	probably benign	0.01
R8782:Wdr60	UTSW	12	116241712	missense	probably damaging	1.00
R8809:Wdr60	UTSW	12	116229614	missense	probably damaging	0.98
R9281:Wdr60	UTSW	12	116248057	nonsense	probably null
R9530:Wdr60	UTSW	12	116211791	missense	possibly damaging	0.87
R9751:Wdr60	UTSW	12	116241783	critical splice acceptor site	probably null
V7581:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7582:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7583:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
X0063:Wdr60	UTSW	12	116255869	missense	probably benign
Z1177:Wdr60	UTSW	12	116246099	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTCGACTCAAGAGGTCATGGTAGG -3'
(R):5'- TGCCCAGACAGTGACAGTAAATGC -3'

Sequencing Primer
(F):5'- ctctgcttcttggtctcgat -3'
(R):5'- GCTTTCATAGTGACAGAGGGTC -3'

Posted On

2013-11-18