Incidental Mutation 'R1065:Ppp1r3g'
ID85975
Institutional Source Beutler Lab
Gene Symbol Ppp1r3g
Ensembl Gene ENSMUSG00000050423
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3G
Synonyms
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location35958839-35970388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35969435 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 279 (D279E)
Ref Sequence ENSEMBL: ENSMUSP00000153702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132661] [ENSMUST00000225537]
Predicted Effect probably benign
Transcript: ENSMUST00000132661
AA Change: D279E

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122712
Gene: ENSMUSG00000050423
AA Change: D279E

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
Pfam:CBM_21 202 339 9.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223592
Predicted Effect probably benign
Transcript: ENSMUST00000225537
AA Change: D279E

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1085 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Ppp1r3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Ppp1r3g APN 13 35968995 missense possibly damaging 0.90
IGL02890:Ppp1r3g APN 13 35969331 missense probably damaging 0.98
R0413:Ppp1r3g UTSW 13 35969348 missense probably damaging 1.00
R4497:Ppp1r3g UTSW 13 35969620 missense probably benign 0.15
R5677:Ppp1r3g UTSW 13 35969262 missense probably damaging 1.00
R6705:Ppp1r3g UTSW 13 35968897 missense probably benign 0.08
X0027:Ppp1r3g UTSW 13 35969223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACGATGCCTGATCCTCTCTTG -3'
(R):5'- ATCGCTCCACGCTCTGTCAATG -3'

Sequencing Primer
(F):5'- GACAGCGAGTGTGCCTG -3'
(R):5'- TCTGTGGAGCACACATAGC -3'
Posted On2013-11-18