Mutagenetix > Incidental Mutation

Incidental Mutation 'R1065:Snx9'

85978

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

MMRRC Submission

039151-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R1065 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 5902361 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

AlphaFold

Q91VH2

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000002436

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	A	G	6: 129,323,050	I155T	possibly damaging	Het
Cd300ld2	T	C	11: 115,013,760	T94A	probably damaging	Het
Cdc42bpg	G	A	19: 6,322,826	S1515N	probably damaging	Het
Ckb	T	C	12: 111,671,247	E150G	probably benign	Het
Cobl	T	A	11: 12,254,327	M785L	possibly damaging	Het
Col6a5	T	C	9: 105,881,783	N2075D	probably damaging	Het
Commd7	G	C	2: 153,619,527		probably benign	Het
Corin	G	A	5: 72,301,650	R927*	probably null	Het
Ift122	A	T	6: 115,875,325		probably null	Het
Il1b	G	A	2: 129,368,007	T83I	probably benign	Het
Ints4	T	C	7: 97,507,892		probably null	Het
Msh6	T	G	17: 87,988,463		probably benign	Het
Mtmr3	T	C	11: 4,492,859	K392E	probably damaging	Het
Olfr1094	A	G	2: 86,829,544	H264R	probably damaging	Het
Pde3a	T	C	6: 141,476,732		probably benign	Het
Pde6h	A	C	6: 136,959,370	K37T	probably damaging	Het
Plat	C	A	8: 22,776,863	D290E	probably damaging	Het
Polk	A	C	13: 96,508,252	L122R	probably damaging	Het
Ppp1r3g	T	A	13: 35,969,435	D279E	probably benign	Het
Ptpru	T	C	4: 131,808,340	E370G	possibly damaging	Het
Ralgapa2	T	C	2: 146,450,558	Y187C	probably benign	Het
Rps6ka2	C	T	17: 7,281,758		probably benign	Het
Slit3	T	C	11: 35,121,635	S41P	possibly damaging	Het
Smarca5	A	T	8: 80,704,714	L958Q	probably damaging	Het
Stkld1	A	T	2: 26,940,038	N72I	probably damaging	Het
Strc	C	A	2: 121,366,651	D1532Y	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Svil	T	G	18: 5,063,777		probably benign	Het
Traf3ip1	T	A	1: 91,500,784	D122E	unknown	Het
Vmn2r7	A	T	3: 64,707,138	D509E	possibly damaging	Het
Vps52	C	A	17: 33,961,239	Q306K	probably benign	Het
Wdr60	C	T	12: 116,256,076	R82H	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp418	C	A	7: 7,181,562	Q175K	probably benign	Het
Zxdc	T	C	6: 90,378,903	S465P	probably damaging	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
PIT4495001:Snx9	UTSW	17	5920126	missense	possibly damaging	0.54
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1421:Snx9	UTSW	17	5902484	missense	probably benign	0.45
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1823:Snx9	UTSW	17	5920671	missense	probably damaging	1.00
R1914:Snx9	UTSW	17	5928256	missense	possibly damaging	0.65
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R3871:Snx9	UTSW	17	5891781	missense	probably benign	0.00
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5137:Snx9	UTSW	17	5928253	missense	probably damaging	1.00
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5624:Snx9	UTSW	17	5891809	nonsense	probably null
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6263:Snx9	UTSW	17	5887049	missense	probably damaging	0.98
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00
R7873:Snx9	UTSW	17	5918476	missense	possibly damaging	0.81
R8471:Snx9	UTSW	17	5890090	missense	probably damaging	1.00
R9451:Snx9	UTSW	17	5899493	missense	probably damaging	0.99
R9748:Snx9	UTSW	17	5899395	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTTAATGCCGACTGCAAAGCCTG -3'
(R):5'- TTCTTACATTGCACGCACGCAC -3'

Sequencing Primer
(F):5'- TGCAAAGCCTGTGCTCTAAAG -3'
(R):5'- acacacacacacacacacac -3'

Posted On

2013-11-18