Incidental Mutation 'R1065:Vps52'
List |< first << previous [record 32 of 36] next >> last >|
ID85980
Institutional Source Beutler Lab
Gene Symbol Vps52
Ensembl Gene ENSMUSG00000024319
Gene NameVPS52 GARP complex subunit
Synonymstclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33955812-33966984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33961239 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 306 (Q306K)
Ref Sequence ENSEMBL: ENSMUSP00000133926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]
Predicted Effect probably benign
Transcript: ENSMUST00000025178
AA Change: Q374K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: Q374K

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172558
Predicted Effect probably benign
Transcript: ENSMUST00000173196
AA Change: Q306K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: Q306K

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174588
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Vps52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Vps52 APN 17 33956958 missense possibly damaging 0.96
IGL01098:Vps52 APN 17 33962730 missense possibly damaging 0.90
IGL01705:Vps52 APN 17 33966068 missense probably damaging 1.00
IGL01722:Vps52 APN 17 33961615 nonsense probably null
IGL02992:Vps52 APN 17 33958350 missense probably damaging 0.97
IGL03279:Vps52 APN 17 33957874 missense probably damaging 0.96
R0363:Vps52 UTSW 17 33962117 missense probably benign 0.26
R0762:Vps52 UTSW 17 33960011 missense probably damaging 1.00
R1506:Vps52 UTSW 17 33957894 missense probably damaging 1.00
R3760:Vps52 UTSW 17 33960188 missense possibly damaging 0.64
R4714:Vps52 UTSW 17 33961179 missense probably benign 0.25
R5381:Vps52 UTSW 17 33958301 missense possibly damaging 0.77
R5590:Vps52 UTSW 17 33961221 missense probably benign 0.01
R5928:Vps52 UTSW 17 33961126 missense possibly damaging 0.85
R6003:Vps52 UTSW 17 33956094 start codon destroyed probably null 0.01
R6302:Vps52 UTSW 17 33963215 missense probably damaging 1.00
R6574:Vps52 UTSW 17 33962478 missense probably null 0.34
R6695:Vps52 UTSW 17 33963199 nonsense probably null
R6888:Vps52 UTSW 17 33963206 missense probably benign 0.06
R7022:Vps52 UTSW 17 33959319 missense probably benign 0.04
R7136:Vps52 UTSW 17 33965288 missense probably benign 0.00
R7380:Vps52 UTSW 17 33958309 missense possibly damaging 0.82
R7727:Vps52 UTSW 17 33962134 missense probably benign 0.21
R7888:Vps52 UTSW 17 33965751 missense probably damaging 0.98
R8385:Vps52 UTSW 17 33962817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTAAGAAGCACTCGCCGC -3'
(R):5'- CACCCTGAACAGGCACTGAAGATG -3'

Sequencing Primer
(F):5'- CCTTGACAGCCATTAAGGGTG -3'
(R):5'- GATGGGGCACAGGTCAC -3'
Posted On2013-11-18