Incidental Mutation 'R1066:Znhit6'
ID85989
Institutional Source Beutler Lab
Gene Symbol Znhit6
Ensembl Gene ENSMUSG00000074182
Gene Namezinc finger, HIT type 6
Synonyms2410019A14Rik
MMRRC Submission 039152-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1066 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145576205-145604795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145578497 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 141 (D141E)
Ref Sequence ENSEMBL: ENSMUSP00000143376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098534] [ENSMUST00000196413] [ENSMUST00000197604] [ENSMUST00000197940] [ENSMUST00000199033] [ENSMUST00000200574]
Predicted Effect probably damaging
Transcript: ENSMUST00000098534
AA Change: D285E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096136
Gene: ENSMUSG00000074182
AA Change: D285E

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 118 150 N/A INTRINSIC
Pfam:zf-HIT 208 237 4.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196413
AA Change: D141E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143376
Gene: ENSMUSG00000074182
AA Change: D141E

DomainStartEndE-ValueType
Pfam:zf-HIT 64 93 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197604
AA Change: D117E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143484
Gene: ENSMUSG00000074182
AA Change: D117E

DomainStartEndE-ValueType
Pfam:zf-HIT 40 69 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197940
Predicted Effect probably damaging
Transcript: ENSMUST00000199033
AA Change: D117E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143306
Gene: ENSMUSG00000074182
AA Change: D117E

DomainStartEndE-ValueType
Pfam:zf-HIT 40 69 4.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200574
AA Change: D117E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143259
Gene: ENSMUSG00000074182
AA Change: D117E

DomainStartEndE-ValueType
Pfam:zf-HIT 40 69 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T A 9: 30,956,541 C554S probably damaging Het
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Brf2 T C 8: 27,123,946 E404G probably benign Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Dtx4 G T 19: 12,501,009 T70K probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gm11487 C A 4: 73,401,829 V238L possibly damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Pik3r1 T A 13: 101,688,663 R465S probably damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Slc25a18 A G 6: 120,788,288 probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vmn2r86 C T 10: 130,446,276 V824I probably benign Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Other mutations in Znhit6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Znhit6 APN 3 145578160 missense probably damaging 1.00
IGL00969:Znhit6 APN 3 145594596 splice site probably benign
IGL01588:Znhit6 APN 3 145596207 splice site probably benign
IGL01911:Znhit6 APN 3 145578098 splice site probably benign
IGL02118:Znhit6 APN 3 145578104 missense probably damaging 1.00
R1115:Znhit6 UTSW 3 145594685 splice site probably null
R2278:Znhit6 UTSW 3 145576236 unclassified probably benign
R2391:Znhit6 UTSW 3 145594658 missense probably damaging 1.00
R2656:Znhit6 UTSW 3 145578169 critical splice donor site probably null
R2877:Znhit6 UTSW 3 145576654 missense probably benign 0.31
R3825:Znhit6 UTSW 3 145578344 missense probably benign 0.17
R4636:Znhit6 UTSW 3 145600579 missense probably null 0.11
R4636:Znhit6 UTSW 3 145600578 splice site silent
R5295:Znhit6 UTSW 3 145600493 missense probably benign 0.41
R5964:Znhit6 UTSW 3 145576933 missense possibly damaging 0.66
R5965:Znhit6 UTSW 3 145578348 missense possibly damaging 0.80
R6537:Znhit6 UTSW 3 145594619 missense probably benign 0.32
X0065:Znhit6 UTSW 3 145578486 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGACCGCTTATGTGTCGCTGC -3'
(R):5'- TGTCCCGTCTCAGGAAAGCTCATC -3'

Sequencing Primer
(F):5'- CAGCAGTTTACTGAGATGAATCTCC -3'
(R):5'- GTGCTGATAATCACACTCTGCG -3'
Posted On2013-11-18