Incidental Mutation 'R1066:Gm11487'
ID85991
Institutional Source Beutler Lab
Gene Symbol Gm11487
Ensembl Gene ENSMUSG00000066137
Gene Namepredicted gene 11487
Synonyms
MMRRC Submission 039152-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R1066 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location73401032-73405072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73401829 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 238 (V238L)
Ref Sequence ENSEMBL: ENSMUSP00000081520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084480
AA Change: V238L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081520
Gene: ENSMUSG00000066137
AA Change: V238L

DomainStartEndE-ValueType
low complexity region 69 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147434
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to a family of related genes tandemly arranged in two clusters on chromosome 4. This family, which appears to be mouse-specific and composed of multiple highly similar members, is supported by limited transcript data. Members of the family maintain an intact open reading frame although the encoded protein has no known function. This gene is inferred from alignment of paralogous transcripts. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T A 9: 30,956,541 C554S probably damaging Het
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Brf2 T C 8: 27,123,946 E404G probably benign Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Dtx4 G T 19: 12,501,009 T70K probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Pik3r1 T A 13: 101,688,663 R465S probably damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Slc25a18 A G 6: 120,788,288 probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vmn2r86 C T 10: 130,446,276 V824I probably benign Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Znhit6 T A 3: 145,578,497 D141E probably damaging Het
Other mutations in Gm11487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Gm11487 APN 4 73403643 missense probably benign 0.01
IGL03275:Gm11487 APN 4 73403416 missense possibly damaging 0.80
R1274:Gm11487 UTSW 4 73403076 missense probably damaging 0.97
R1742:Gm11487 UTSW 4 73401210 missense probably damaging 1.00
R1863:Gm11487 UTSW 4 73401800 nonsense probably null
R1903:Gm11487 UTSW 4 73403438 missense probably damaging 0.98
R2027:Gm11487 UTSW 4 73403058 missense possibly damaging 0.46
R4011:Gm11487 UTSW 4 73401810 missense probably damaging 0.97
R4801:Gm11487 UTSW 4 73401267 nonsense probably null
R4802:Gm11487 UTSW 4 73401267 nonsense probably null
R5213:Gm11487 UTSW 4 73401334 missense probably damaging 0.96
R5334:Gm11487 UTSW 4 73403517 missense probably benign 0.31
R5345:Gm11487 UTSW 4 73401277 missense probably damaging 1.00
R6093:Gm11487 UTSW 4 73402021 missense probably benign 0.05
R6786:Gm11487 UTSW 4 73403606 missense possibly damaging 0.86
R8033:Gm11487 UTSW 4 73403092 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCTCAGCTCTGTCCTCATGAAG -3'
(R):5'- GCTCTCCTGCAAGTGTTCCCAATG -3'

Sequencing Primer
(F):5'- AGGACAGGCCATCTGATGC -3'
(R):5'- CAGTTCAATGTTCAGGGAGAATCC -3'
Posted On2013-11-18