Incidental Mutation 'R1066:Slc25a18'
ID86000
Institutional Source Beutler Lab
Gene Symbol Slc25a18
Ensembl Gene ENSMUSG00000004902
Gene Namesolute carrier family 25 (mitochondrial carrier), member 18
Synonyms
MMRRC Submission 039152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1066 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location120773578-120794336 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 120788288 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112682]
Predicted Effect probably null
Transcript: ENSMUST00000112682
SMART Domains Protein: ENSMUSP00000108302
Gene: ENSMUSG00000004902

DomainStartEndE-ValueType
Pfam:Mito_carr 9 102 6.8e-27 PFAM
Pfam:Mito_carr 104 218 1.2e-17 PFAM
Pfam:Mito_carr 222 310 7.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T A 9: 30,956,541 C554S probably damaging Het
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Brf2 T C 8: 27,123,946 E404G probably benign Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Dtx4 G T 19: 12,501,009 T70K probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gm11487 C A 4: 73,401,829 V238L possibly damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Pik3r1 T A 13: 101,688,663 R465S probably damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vmn2r86 C T 10: 130,446,276 V824I probably benign Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Znhit6 T A 3: 145,578,497 D141E probably damaging Het
Other mutations in Slc25a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Slc25a18 APN 6 120792397 unclassified probably null
R1618:Slc25a18 UTSW 6 120786342 splice site probably benign
R2220:Slc25a18 UTSW 6 120793557 unclassified probably null
R4715:Slc25a18 UTSW 6 120786090 missense probably damaging 1.00
R5786:Slc25a18 UTSW 6 120792074 missense probably damaging 0.99
R5873:Slc25a18 UTSW 6 120786281 critical splice acceptor site probably null
R6103:Slc25a18 UTSW 6 120789438 missense probably damaging 1.00
R6719:Slc25a18 UTSW 6 120788254 missense probably damaging 1.00
R8032:Slc25a18 UTSW 6 120792491 missense probably damaging 1.00
Z1176:Slc25a18 UTSW 6 120789365 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCTTATTGTGAGTGGCAGCAGC -3'
(R):5'- AGGCAGCTTGTGTATCCATCAGCG -3'

Sequencing Primer
(F):5'- GCAGCCACAGCTCCTTC -3'
(R):5'- CTCAGCCACATGTGCACATAT -3'
Posted On2013-11-18