Incidental Mutation 'R1066:Brf2'
ID86007
Institutional Source Beutler Lab
Gene Symbol Brf2
Ensembl Gene ENSMUSG00000031487
Gene NameBRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms5730512K07Rik, TFIIIB50, 2700059M06Rik, BRFU
MMRRC Submission 039152-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1066 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location27123364-27128680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27123946 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 404 (E404G)
Ref Sequence ENSEMBL: ENSMUSP00000033877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000033877] [ENSMUST00000178514] [ENSMUST00000179351] [ENSMUST00000209770] [ENSMUST00000210552] [ENSMUST00000211151]
Predicted Effect probably benign
Transcript: ENSMUST00000033876
SMART Domains Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 1.06e2 SMART
LRR_TYP 107 130 2.71e-2 SMART
LRR_TYP 131 154 1.28e-3 SMART
LRR 155 178 7.38e1 SMART
LRRCT 190 240 4.63e-6 SMART
IG 253 346 3.49e-3 SMART
low complexity region 629 639 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Pfam:GPS 709 750 1.1e-7 PFAM
Pfam:7tm_2 770 990 5.3e-13 PFAM
transmembrane domain 1016 1038 N/A INTRINSIC
transmembrane domain 1045 1064 N/A INTRINSIC
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1110 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033877
AA Change: E404G

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033877
Gene: ENSMUSG00000031487
AA Change: E404G

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 6 42 5.7e-11 PFAM
SCOP:d1aisb1 73 167 1e-12 SMART
Blast:CYCLIN 74 158 2e-51 BLAST
Blast:CYCLIN 171 275 6e-61 BLAST
low complexity region 322 336 N/A INTRINSIC
low complexity region 355 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178514
SMART Domains Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 4.4e-1 SMART
LRR_TYP 107 130 1.1e-4 SMART
LRR_TYP 131 154 5.3e-6 SMART
LRR 155 178 3.1e-1 SMART
LRRCT 190 240 2.2e-8 SMART
IG 253 346 1.4e-5 SMART
HormR 349 426 1.8e-4 SMART
Pfam:7tm_2 554 775 3.2e-11 PFAM
transmembrane domain 801 823 N/A INTRINSIC
transmembrane domain 830 849 N/A INTRINSIC
low complexity region 860 880 N/A INTRINSIC
low complexity region 895 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179207
Predicted Effect probably benign
Transcript: ENSMUST00000179351
SMART Domains Protein: ENSMUSP00000137457
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
Pfam:GPS 5 49 4.5e-11 PFAM
transmembrane domain 67 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210230
Predicted Effect probably benign
Transcript: ENSMUST00000210552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210590
Predicted Effect probably benign
Transcript: ENSMUST00000211151
Predicted Effect probably benign
Transcript: ENSMUST00000211236
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the multiple subunits of the RNA polymerase III transcription factor complex required for transcription of genes with promoter elements upstream of the initiation site. The product of this gene, a TFIIB-like factor, is directly recruited to the TATA-box of polymerase III small nuclear RNA gene promoters through its interaction with the TATA-binding protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T A 9: 30,956,541 C554S probably damaging Het
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Dtx4 G T 19: 12,501,009 T70K probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gm11487 C A 4: 73,401,829 V238L possibly damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Pik3r1 T A 13: 101,688,663 R465S probably damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Slc25a18 A G 6: 120,788,288 probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vmn2r86 C T 10: 130,446,276 V824I probably benign Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Znhit6 T A 3: 145,578,497 D141E probably damaging Het
Other mutations in Brf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03371:Brf2 APN 8 27125844 missense probably benign 0.11
R0179:Brf2 UTSW 8 27125868 missense possibly damaging 0.73
R0615:Brf2 UTSW 8 27124031 missense probably benign 0.00
R1882:Brf2 UTSW 8 27128549 missense probably damaging 1.00
R3766:Brf2 UTSW 8 27124468 missense possibly damaging 0.50
R5546:Brf2 UTSW 8 27124283 missense possibly damaging 0.67
R5716:Brf2 UTSW 8 27126046 missense probably benign
R6965:Brf2 UTSW 8 27124558 missense probably benign 0.34
R7903:Brf2 UTSW 8 27126093 missense possibly damaging 0.77
R7986:Brf2 UTSW 8 27126093 missense possibly damaging 0.77
X0026:Brf2 UTSW 8 27126051 missense probably benign
Z1088:Brf2 UTSW 8 27123991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTAGGATGCAGCTCGTTCAC -3'
(R):5'- CCCTTCGATTTGCCCAAGAGGAAAC -3'

Sequencing Primer
(F):5'- CTTAGGAAGGATTCATCCTGGAC -3'
(R):5'- GAAACGTCCCGCCAGTC -3'
Posted On2013-11-18