Incidental Mutation 'R1066:Adamts8'
ID86011
Institutional Source Beutler Lab
Gene Symbol Adamts8
Ensembl Gene ENSMUSG00000031994
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
SynonymsMETH-2, METH2
MMRRC Submission 039152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1066 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location30942562-30963838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30956541 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 554 (C554S)
Ref Sequence ENSEMBL: ENSMUSP00000069644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]
Predicted Effect probably damaging
Transcript: ENSMUST00000068135
AA Change: C554S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: C554S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 152 6.4e-23 PFAM
Pfam:Reprolysin_5 232 418 1.3e-15 PFAM
Pfam:Reprolysin_4 233 435 3.4e-8 PFAM
Pfam:Reprolysin 234 444 3.8e-21 PFAM
Pfam:Reprolysin_2 252 434 1.3e-10 PFAM
Pfam:Reprolysin_3 255 389 7.4e-14 PFAM
TSP1 545 597 7.04e-14 SMART
Pfam:ADAM_spacer1 706 825 3.2e-35 PFAM
TSP1 851 904 5.35e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163037
SMART Domains Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994

DomainStartEndE-ValueType
PDB:2V4B|B 22 128 2e-38 PDB
SCOP:d1kufa_ 27 128 2e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214688
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Brf2 T C 8: 27,123,946 E404G probably benign Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Dtx4 G T 19: 12,501,009 T70K probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gm11487 C A 4: 73,401,829 V238L possibly damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Pik3r1 T A 13: 101,688,663 R465S probably damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Slc25a18 A G 6: 120,788,288 probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vmn2r86 C T 10: 130,446,276 V824I probably benign Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Znhit6 T A 3: 145,578,497 D141E probably damaging Het
Other mutations in Adamts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Adamts8 APN 9 30953500 missense probably damaging 1.00
IGL02049:Adamts8 APN 9 30951354 missense probably damaging 0.96
IGL02304:Adamts8 APN 9 30956656 missense possibly damaging 0.55
IGL02385:Adamts8 APN 9 30961730 missense probably benign 0.10
IGL02536:Adamts8 APN 9 30962072 missense probably benign 0.05
IGL03347:Adamts8 APN 9 30959238 missense possibly damaging 0.75
R0633:Adamts8 UTSW 9 30943511 missense probably damaging 1.00
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1560:Adamts8 UTSW 9 30956667 missense probably damaging 1.00
R1592:Adamts8 UTSW 9 30943176 missense probably damaging 0.99
R1753:Adamts8 UTSW 9 30954614 missense probably benign 0.04
R1932:Adamts8 UTSW 9 30956512 missense probably benign
R2087:Adamts8 UTSW 9 30962112 missense probably damaging 1.00
R2118:Adamts8 UTSW 9 30943063 missense probably damaging 1.00
R3789:Adamts8 UTSW 9 30959292 missense probably damaging 1.00
R4165:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4166:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4193:Adamts8 UTSW 9 30959308 missense probably damaging 1.00
R4425:Adamts8 UTSW 9 30956656 missense possibly damaging 0.55
R5155:Adamts8 UTSW 9 30954548 missense probably benign 0.33
R5433:Adamts8 UTSW 9 30961716 missense probably benign 0.01
R5544:Adamts8 UTSW 9 30952703 missense probably damaging 1.00
R5590:Adamts8 UTSW 9 30951336 missense probably damaging 0.97
R5640:Adamts8 UTSW 9 30956500 missense probably benign 0.00
R5800:Adamts8 UTSW 9 30954482 missense probably damaging 1.00
R5909:Adamts8 UTSW 9 30961928 missense probably benign 0.00
R6821:Adamts8 UTSW 9 30956626 missense probably benign 0.08
R6967:Adamts8 UTSW 9 30954491 missense probably benign 0.04
R7336:Adamts8 UTSW 9 30962067 missense probably benign 0.00
R7538:Adamts8 UTSW 9 30953470 missense probably damaging 1.00
R7540:Adamts8 UTSW 9 30959064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGAGGCACGCCATCATTAAGCAAG -3'
(R):5'- TCTCTCAACAGCTCAGAAGACCAGG -3'

Sequencing Primer
(F):5'- acgccatcattaagcaagcaaTC -3'
(R):5'- TCTTGCAGAGCCCATGTAAATC -3'
Posted On2013-11-18