Incidental Mutation 'R1066:Vmn2r86'
Institutional Source Beutler Lab
Gene Symbol Vmn2r86
Ensembl Gene ENSMUSG00000092162
Gene Namevomeronasal 2, receptor 86
MMRRC Submission 039152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1066 (G1)
Quality Score206
Status Not validated
Chromosomal Location130445707-130455894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130446276 bp
Amino Acid Change Valine to Isoleucine at position 824 (V824I)
Ref Sequence ENSEMBL: ENSMUSP00000126596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170257]
Predicted Effect probably benign
Transcript: ENSMUST00000170257
AA Change: V824I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126596
Gene: ENSMUSG00000092162
AA Change: V824I

signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 1.1e-25 PFAM
Pfam:NCD3G 508 562 2.4e-19 PFAM
Pfam:7tm_3 595 829 6.4e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T A 9: 30,956,541 C554S probably damaging Het
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Brf2 T C 8: 27,123,946 E404G probably benign Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Dtx4 G T 19: 12,501,009 T70K probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gm11487 C A 4: 73,401,829 V238L possibly damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Pik3r1 T A 13: 101,688,663 R465S probably damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Slc25a18 A G 6: 120,788,288 probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Znhit6 T A 3: 145,578,497 D141E probably damaging Het
Other mutations in Vmn2r86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Vmn2r86 APN 10 130453026 missense probably damaging 0.99
IGL01328:Vmn2r86 APN 10 130452496 missense possibly damaging 0.78
IGL01377:Vmn2r86 APN 10 130452986 missense probably damaging 0.99
IGL01548:Vmn2r86 APN 10 130446282 missense probably benign 0.22
IGL01804:Vmn2r86 APN 10 130452989 missense probably damaging 0.99
IGL01921:Vmn2r86 APN 10 130455741 missense probably benign 0.00
IGL02406:Vmn2r86 APN 10 130448639 missense possibly damaging 0.81
IGL02625:Vmn2r86 APN 10 130452912 missense probably damaging 1.00
IGL02960:Vmn2r86 APN 10 130453767 missense possibly damaging 0.74
IGL03104:Vmn2r86 APN 10 130446632 missense probably damaging 1.00
R0408:Vmn2r86 UTSW 10 130446854 missense probably damaging 1.00
R0437:Vmn2r86 UTSW 10 130446543 missense probably damaging 1.00
R0577:Vmn2r86 UTSW 10 130452575 missense probably benign 0.04
R0726:Vmn2r86 UTSW 10 130446396 missense probably damaging 1.00
R0811:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R0812:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R1055:Vmn2r86 UTSW 10 130446357 missense probably damaging 1.00
R1199:Vmn2r86 UTSW 10 130448574 splice site probably benign
R1332:Vmn2r86 UTSW 10 130446870 missense probably damaging 1.00
R1568:Vmn2r86 UTSW 10 130453141 missense probably benign 0.09
R1866:Vmn2r86 UTSW 10 130446386 missense probably damaging 1.00
R1897:Vmn2r86 UTSW 10 130452445 missense probably damaging 1.00
R2017:Vmn2r86 UTSW 10 130446713 missense probably benign 0.39
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3858:Vmn2r86 UTSW 10 130455725 missense probably benign
R4049:Vmn2r86 UTSW 10 130447097 missense probably damaging 0.98
R4378:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4411:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4413:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4422:Vmn2r86 UTSW 10 130452976 missense possibly damaging 0.87
R4738:Vmn2r86 UTSW 10 130447070 missense probably damaging 0.99
R4767:Vmn2r86 UTSW 10 130455737 missense probably benign 0.00
R4872:Vmn2r86 UTSW 10 130453591 missense probably damaging 0.98
R4880:Vmn2r86 UTSW 10 130453615 missense probably benign 0.33
R5092:Vmn2r86 UTSW 10 130446587 missense probably damaging 1.00
R5421:Vmn2r86 UTSW 10 130446936 missense probably benign 0.41
R6007:Vmn2r86 UTSW 10 130453666 missense probably damaging 1.00
R6330:Vmn2r86 UTSW 10 130446527 missense probably benign 0.05
R6355:Vmn2r86 UTSW 10 130455894 start codon destroyed probably damaging 0.98
R6397:Vmn2r86 UTSW 10 130446262 nonsense probably null
R6419:Vmn2r86 UTSW 10 130446926 missense probably damaging 1.00
R6933:Vmn2r86 UTSW 10 130446257 missense probably damaging 1.00
R6937:Vmn2r86 UTSW 10 130448654 missense probably damaging 1.00
R6959:Vmn2r86 UTSW 10 130446531 missense probably damaging 1.00
R7010:Vmn2r86 UTSW 10 130455857 missense probably benign
R7549:Vmn2r86 UTSW 10 130446828 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tccatcctatctacagtcttctttc -3'
Posted On2013-11-18