Incidental Mutation 'R1066:Pik3r1'
ID86020
Institutional Source Beutler Lab
Gene Symbol Pik3r1
Ensembl Gene ENSMUSG00000041417
Gene Namephosphoinositide-3-kinase regulatory subunit 1
Synonymsp55alpha, p85alpha, PI3K, p50alpha
MMRRC Submission 039152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1066 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location101680563-101768217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101688663 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 465 (R465S)
Ref Sequence ENSEMBL: ENSMUSP00000056774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035532] [ENSMUST00000055518] [ENSMUST00000185795] [ENSMUST00000187009]
Predicted Effect probably benign
Transcript: ENSMUST00000035532
AA Change: R195S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047004
Gene: ENSMUSG00000041417
AA Change: R195S

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
SH2 61 144 9.96e-28 SMART
low complexity region 263 278 N/A INTRINSIC
SH2 352 434 7.33e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000055518
AA Change: R465S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056774
Gene: ENSMUSG00000041417
AA Change: R465S

DomainStartEndE-ValueType
SH3 6 78 2.81e-11 SMART
low complexity region 79 99 N/A INTRINSIC
RhoGAP 126 298 1.94e-37 SMART
low complexity region 303 314 N/A INTRINSIC
SH2 331 414 9.96e-28 SMART
Pfam:PI3K_P85_iSH2 431 599 7.8e-67 PFAM
SH2 622 704 7.33e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185795
SMART Domains Protein: ENSMUSP00000140312
Gene: ENSMUSG00000041417

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
SH2 31 112 1.52e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187009
AA Change: R144S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140256
Gene: ENSMUSG00000041417
AA Change: R144S

DomainStartEndE-ValueType
SH2 10 93 6.5e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190171
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit perinatal lethality associated with hepatic necrosis, chylous ascites, enlarged muscle fibers, calcification of cardiac tissue, and hypoglycemia. Mutants lacking only the major isoform are immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T A 9: 30,956,541 C554S probably damaging Het
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Brf2 T C 8: 27,123,946 E404G probably benign Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Dtx4 G T 19: 12,501,009 T70K probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gm11487 C A 4: 73,401,829 V238L possibly damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Slc25a18 A G 6: 120,788,288 probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vmn2r86 C T 10: 130,446,276 V824I probably benign Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Znhit6 T A 3: 145,578,497 D141E probably damaging Het
Other mutations in Pik3r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pik3r1 APN 13 101690536 start codon destroyed probably benign
IGL00484:Pik3r1 APN 13 101701747 missense probably benign 0.08
IGL00911:Pik3r1 APN 13 101757661 utr 5 prime probably benign
IGL01620:Pik3r1 APN 13 101686220 missense probably damaging 1.00
IGL01872:Pik3r1 APN 13 101689117 missense probably benign 0.01
IGL02544:Pik3r1 APN 13 101687276 missense probably damaging 1.00
IGL02959:Pik3r1 APN 13 101757529 missense probably benign 0.02
anubis UTSW 13 101702776 nonsense probably null
astro_boy UTSW 13 101701732 missense probably damaging 1.00
pennywhistle UTSW 13 101689406 missense probably damaging 0.96
Rocket UTSW 13 101689444 missense probably damaging 1.00
R0635:Pik3r1 UTSW 13 101757418 missense probably benign
R0751:Pik3r1 UTSW 13 101686358 unclassified probably null
R0787:Pik3r1 UTSW 13 101690523 missense probably benign 0.30
R0845:Pik3r1 UTSW 13 101686264 missense probably benign 0.45
R0891:Pik3r1 UTSW 13 101701466 missense probably benign
R1184:Pik3r1 UTSW 13 101686358 unclassified probably null
R1735:Pik3r1 UTSW 13 101686374 missense probably damaging 1.00
R2474:Pik3r1 UTSW 13 101702776 nonsense probably null
R3015:Pik3r1 UTSW 13 101687263 missense probably damaging 1.00
R3419:Pik3r1 UTSW 13 101692215 missense probably benign 0.17
R3876:Pik3r1 UTSW 13 101684957 missense probably benign 0.01
R3964:Pik3r1 UTSW 13 101688685 missense possibly damaging 0.75
R4175:Pik3r1 UTSW 13 101701732 missense probably damaging 1.00
R4175:Pik3r1 UTSW 13 101701733 missense probably benign 0.25
R4422:Pik3r1 UTSW 13 101694384 missense probably benign
R4890:Pik3r1 UTSW 13 101757610 missense probably damaging 1.00
R5038:Pik3r1 UTSW 13 101689444 missense probably damaging 1.00
R5117:Pik3r1 UTSW 13 101692236 missense probably benign
R6066:Pik3r1 UTSW 13 101686320 missense possibly damaging 0.72
R6254:Pik3r1 UTSW 13 101689406 missense possibly damaging 0.89
R7421:Pik3r1 UTSW 13 101689136 missense probably damaging 1.00
R7507:Pik3r1 UTSW 13 101708982 missense probably benign 0.00
R7538:Pik3r1 UTSW 13 101689406 missense probably damaging 0.96
R7605:Pik3r1 UTSW 13 101702838 missense probably benign
R7739:Pik3r1 UTSW 13 101709697 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTGCGAGTTAGAAGCAAGCTTAATG -3'
(R):5'- GTTGCTCTACCCAGTGTCCAAATACC -3'

Sequencing Primer
(F):5'- GTAGGACTTTATAAGCATGGGTTAAG -3'
(R):5'- GGCCAGAGACTCTTCAGCATAG -3'
Posted On2013-11-18