Incidental Mutation 'R1066:Nup155'
ID86021
Institutional Source Beutler Lab
Gene Symbol Nup155
Ensembl Gene ENSMUSG00000022142
Gene Namenucleoporin 155
SynonymsD930027M19Rik
MMRRC Submission 039152-MU
Accession Numbers

Genbank: NM_133227

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1066 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location8109273-8161247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8157760 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1391 (H1391L)
Ref Sequence ENSEMBL: ENSMUSP00000128819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]
Predicted Effect probably damaging
Transcript: ENSMUST00000163765
AA Change: H1391L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: H1391L

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Nucleoporin_N 77 510 3.5e-105 PFAM
low complexity region 600 619 N/A INTRINSIC
Pfam:Nucleoporin_C 678 1221 3.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230925
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T A 9: 30,956,541 C554S probably damaging Het
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Brf2 T C 8: 27,123,946 E404G probably benign Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Dtx4 G T 19: 12,501,009 T70K probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gm11487 C A 4: 73,401,829 V238L possibly damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Pik3r1 T A 13: 101,688,663 R465S probably damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Slc25a18 A G 6: 120,788,288 probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vmn2r86 C T 10: 130,446,276 V824I probably benign Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Znhit6 T A 3: 145,578,497 D141E probably damaging Het
Other mutations in Nup155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nup155 APN 15 8121455 splice site probably benign
IGL00426:Nup155 APN 15 8156794 makesense probably null
IGL00765:Nup155 APN 15 8153228 missense probably benign 0.16
IGL00936:Nup155 APN 15 8128405 splice site probably benign
IGL01124:Nup155 APN 15 8153679 missense probably damaging 0.97
IGL01739:Nup155 APN 15 8135788 missense probably benign 0.01
IGL02013:Nup155 APN 15 8113648 missense possibly damaging 0.61
IGL02066:Nup155 APN 15 8157766 unclassified probably benign
IGL02231:Nup155 APN 15 8144064 missense probably damaging 1.00
IGL02246:Nup155 APN 15 8143002 missense probably benign
IGL02289:Nup155 APN 15 8131493 missense probably damaging 1.00
IGL02608:Nup155 APN 15 8109471 missense probably benign
IGL02749:Nup155 APN 15 8134076 missense probably damaging 1.00
IGL02813:Nup155 APN 15 8130121 splice site probably benign
IGL03102:Nup155 APN 15 8147284 missense probably benign 0.00
H8930:Nup155 UTSW 15 8157658 missense possibly damaging 0.50
IGL02835:Nup155 UTSW 15 8143130 missense probably damaging 1.00
R0314:Nup155 UTSW 15 8147252 missense probably benign 0.00
R0365:Nup155 UTSW 15 8131543 missense probably damaging 1.00
R0586:Nup155 UTSW 15 8130232 missense probably benign 0.39
R0764:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R0839:Nup155 UTSW 15 8145587 missense possibly damaging 0.48
R0844:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1067:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1085:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1137:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1162:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1166:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1202:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1203:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1219:Nup155 UTSW 15 8117338 missense possibly damaging 0.80
R1385:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1421:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1448:Nup155 UTSW 15 8112406 missense probably benign 0.44
R1611:Nup155 UTSW 15 8130160 missense probably damaging 1.00
R1836:Nup155 UTSW 15 8154980 missense possibly damaging 0.79
R1863:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1866:Nup155 UTSW 15 8115526 missense probably damaging 1.00
R1894:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1976:Nup155 UTSW 15 8135827 missense probably benign 0.01
R2024:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2026:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2027:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2077:Nup155 UTSW 15 8143026 missense probably damaging 1.00
R2111:Nup155 UTSW 15 8121467 missense probably benign 0.45
R2921:Nup155 UTSW 15 8153641 missense probably damaging 1.00
R2936:Nup155 UTSW 15 8143049 missense possibly damaging 0.89
R3108:Nup155 UTSW 15 8117306 missense probably null 1.00
R3161:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3522:Nup155 UTSW 15 8156678 splice site probably benign
R4423:Nup155 UTSW 15 8121464 missense probably damaging 0.99
R4451:Nup155 UTSW 15 8150882 missense probably benign 0.02
R4498:Nup155 UTSW 15 8153673 missense possibly damaging 0.88
R4780:Nup155 UTSW 15 8157703 missense probably benign 0.00
R4822:Nup155 UTSW 15 8128526 missense possibly damaging 0.49
R5013:Nup155 UTSW 15 8124238 missense probably benign 0.00
R5064:Nup155 UTSW 15 8135870 missense probably damaging 1.00
R5172:Nup155 UTSW 15 8109542 missense probably benign 0.06
R5406:Nup155 UTSW 15 8153638 critical splice acceptor site probably null
R5551:Nup155 UTSW 15 8148333 missense probably benign 0.09
R5588:Nup155 UTSW 15 8119253 critical splice donor site probably null
R5977:Nup155 UTSW 15 8130237 critical splice donor site probably null
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6085:Nup155 UTSW 15 8148358 missense probably damaging 0.98
R6188:Nup155 UTSW 15 8109575 missense probably damaging 1.00
R6232:Nup155 UTSW 15 8109479 missense probably benign 0.02
R6257:Nup155 UTSW 15 8150798 nonsense probably null
R6262:Nup155 UTSW 15 8156741 missense probably benign 0.03
R6267:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6296:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6299:Nup155 UTSW 15 8128438 missense possibly damaging 0.88
R6303:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6304:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6763:Nup155 UTSW 15 8135895 nonsense probably null
R6958:Nup155 UTSW 15 8147154 missense probably damaging 1.00
R7088:Nup155 UTSW 15 8156693 missense probably benign 0.11
R7313:Nup155 UTSW 15 8154922 missense probably damaging 0.96
R7451:Nup155 UTSW 15 8145607 nonsense probably null
R7560:Nup155 UTSW 15 8155047 missense probably benign 0.39
R7633:Nup155 UTSW 15 8109453 missense probably damaging 0.99
R7670:Nup155 UTSW 15 8153696 missense probably damaging 0.99
R7726:Nup155 UTSW 15 8122139 missense probably damaging 1.00
R7752:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
R7889:Nup155 UTSW 15 8121507 missense probably damaging 0.98
R7899:Nup155 UTSW 15 8119179 missense probably damaging 1.00
R7901:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
R7972:Nup155 UTSW 15 8121507 missense probably damaging 0.98
R7982:Nup155 UTSW 15 8119179 missense probably damaging 1.00
R7984:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
RF003:Nup155 UTSW 15 8119176 critical splice acceptor site probably benign
RF048:Nup155 UTSW 15 8119176 critical splice acceptor site probably benign
Z1177:Nup155 UTSW 15 8120489 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTCAATGAGTGACCTGAAGTCTTTCTCC -3'
(R):5'- GGGAACAGACCCAGCCTATAAGGTG -3'

Sequencing Primer
(F):5'- GACCTGAAGTCTTTCTCCTTACAG -3'
(R):5'- TGGACCCAGCTGAGCTTTTA -3'
Posted On2013-11-18