Incidental Mutation 'R1066:Dtx4'
ID 86029
Institutional Source Beutler Lab
Gene Symbol Dtx4
Ensembl Gene ENSMUSG00000039982
Gene Name deltex 4, E3 ubiquitin ligase
Synonyms RNF155
MMRRC Submission 039152-MU
Accession Numbers

Genbank: NM_001047855

Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R1066 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12466341-12501996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 12501009 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 70 (T70K)
Ref Sequence ENSEMBL: ENSMUSP00000040229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521]
AlphaFold Q6PDK8
Predicted Effect probably damaging
Transcript: ENSMUST00000045521
AA Change: T70K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: T70K

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T A 9: 30,956,541 C554S probably damaging Het
Adarb2 T G 13: 8,757,323 F720C probably benign Het
Arid5b T C 10: 68,098,356 D572G probably benign Het
BB014433 C T 8: 15,042,185 V223M probably damaging Het
Boc T C 16: 44,490,684 probably null Het
Brf2 T C 8: 27,123,946 E404G probably benign Het
Ces3a T A 8: 105,055,656 H380Q probably benign Het
Chd9 T A 8: 90,986,136 Y389* probably null Het
Csmd3 A G 15: 47,913,965 F1182L probably damaging Het
Dnah2 C A 11: 69,447,819 W3169L probably damaging Het
Dnah3 T A 7: 120,061,009 E802D probably damaging Het
Fat4 T C 3: 38,957,227 Y2159H probably damaging Het
Flrt2 T A 12: 95,779,059 V57E probably damaging Het
Gm11487 C A 4: 73,401,829 V238L possibly damaging Het
Gsdmc2 T A 15: 63,825,050 Y424F possibly damaging Het
Igfn1 T C 1: 135,970,725 E701G probably benign Het
Klhl42 T C 6: 147,107,899 V412A probably benign Het
Mkln1 A C 6: 31,418,987 N52T possibly damaging Het
Mpp6 A T 6: 50,145,867 N31I possibly damaging Het
Myo15b A T 11: 115,879,751 M1519L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1467 T C 19: 13,365,087 M153T probably benign Het
P4ha3 G T 7: 100,318,063 V360L possibly damaging Het
Phf14 T A 6: 11,987,255 D611E possibly damaging Het
Pik3r1 T A 13: 101,688,663 R465S probably damaging Het
Reep3 G T 10: 67,034,666 T117K probably damaging Het
Reln G T 5: 22,034,664 N868K probably damaging Het
Sdcbp T G 4: 6,385,120 I113S probably damaging Het
Sema4c A T 1: 36,550,200 V615E possibly damaging Het
Slc25a18 A G 6: 120,788,288 probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Uba2 A T 7: 34,158,822 F70I probably damaging Het
Usp42 A T 5: 143,718,041 H422Q probably damaging Het
Vmn2r86 C T 10: 130,446,276 V824I probably benign Het
Vps50 A C 6: 3,533,565 T266P probably damaging Het
Znhit6 T A 3: 145,578,497 D141E probably damaging Het
Other mutations in Dtx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Dtx4 APN 19 12478215 missense possibly damaging 0.88
IGL02173:Dtx4 APN 19 12473257 nonsense probably null
IGL03127:Dtx4 APN 19 12486500 splice site probably benign
G5030:Dtx4 UTSW 19 12469579 missense probably benign 0.07
R0143:Dtx4 UTSW 19 12486482 missense probably damaging 0.98
R0932:Dtx4 UTSW 19 12492151 missense probably benign
R2155:Dtx4 UTSW 19 12485282 nonsense probably null
R2182:Dtx4 UTSW 19 12483107 missense probably null 0.75
R2362:Dtx4 UTSW 19 12492535 missense probably damaging 1.00
R3880:Dtx4 UTSW 19 12486456 missense probably benign 0.01
R4108:Dtx4 UTSW 19 12501123 missense probably damaging 0.96
R4361:Dtx4 UTSW 19 12485296 missense probably benign 0.04
R4943:Dtx4 UTSW 19 12501060 missense probably damaging 1.00
R5361:Dtx4 UTSW 19 12485262 critical splice donor site probably null
R5440:Dtx4 UTSW 19 12492317 missense probably damaging 1.00
R5613:Dtx4 UTSW 19 12485403 missense probably damaging 0.97
R5614:Dtx4 UTSW 19 12482183 missense probably damaging 1.00
R5703:Dtx4 UTSW 19 12482210 missense possibly damaging 0.84
R5994:Dtx4 UTSW 19 12501153 missense probably damaging 1.00
R6695:Dtx4 UTSW 19 12473235 nonsense probably null
R7107:Dtx4 UTSW 19 12473260 nonsense probably null
R7208:Dtx4 UTSW 19 12482073 critical splice donor site probably null
R7231:Dtx4 UTSW 19 12469658 nonsense probably null
R7521:Dtx4 UTSW 19 12492497 missense probably benign 0.30
R7609:Dtx4 UTSW 19 12492281 missense probably damaging 1.00
R7721:Dtx4 UTSW 19 12482136 missense probably benign 0.09
R7775:Dtx4 UTSW 19 12492010 missense probably benign 0.02
R8685:Dtx4 UTSW 19 12469631 missense probably benign 0.36
Z1176:Dtx4 UTSW 19 12491909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACGGCTACTAGGGGCTGATGG -3'
(R):5'- CCTTTGCATGAAGCCGCTGGAC -3'

Sequencing Primer
(F):5'- GCATAAAGGGGTTCTCCTGC -3'
(R):5'- CGTGTCCCAGTGCCTAC -3'
Posted On 2013-11-18