Incidental Mutation 'R1067:Kpna6'
ID86042
Institutional Source Beutler Lab
Gene Symbol Kpna6
Ensembl Gene ENSMUSG00000003731
Gene Namekaryopherin (importin) alpha 6
SynonymsIPOA7, NPI-2
MMRRC Submission 039153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1067 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129643980-129672767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129648103 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 500 (H500Q)
Ref Sequence ENSEMBL: ENSMUSP00000099650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003828] [ENSMUST00000102590]
Predicted Effect probably benign
Transcript: ENSMUST00000003828
AA Change: H497Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003828
Gene: ENSMUSG00000003731
AA Change: H497Q

DomainStartEndE-ValueType
Pfam:IBB 2 100 9.5e-28 PFAM
ARM 109 151 2.46e-4 SMART
ARM 153 193 6.73e-11 SMART
ARM 195 236 3.19e-3 SMART
ARM 239 278 6.64e-1 SMART
ARM 280 320 1.16e-5 SMART
ARM 322 362 1.98e-8 SMART
ARM 364 404 6.68e-6 SMART
ARM 407 447 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102590
AA Change: H500Q

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099650
Gene: ENSMUSG00000003731
AA Change: H500Q

DomainStartEndE-ValueType
Pfam:IBB 9 102 4.4e-27 PFAM
ARM 112 154 2.46e-4 SMART
ARM 156 196 6.73e-11 SMART
ARM 198 239 3.19e-3 SMART
ARM 242 281 6.64e-1 SMART
ARM 283 323 1.16e-5 SMART
ARM 325 365 1.98e-8 SMART
ARM 367 407 6.68e-6 SMART
ARM 410 450 1.89e-5 SMART
Pfam:Arm_3 464 514 5.3e-26 PFAM
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. The protein encoded by this gene is a member of the importin alpha family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null mutation are infertile and show a block in zygotic genome activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,823,947 probably benign Het
Adam24 T A 8: 40,680,754 C420* probably null Het
Atp12a G A 14: 56,373,436 G346S probably damaging Het
Bpifa3 A T 2: 154,137,609 Q218L probably damaging Het
Cntrl T C 2: 35,149,022 probably benign Het
Defb41 A G 1: 18,265,024 probably null Het
Edc4 C A 8: 105,891,005 T1094K probably damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
G3bp2 A T 5: 92,063,328 probably benign Het
Herc6 T A 6: 57,662,219 N888K probably damaging Het
Iqgap1 G A 7: 80,723,828 T1471M probably benign Het
Krt78 G A 15: 101,946,461 Q972* probably null Het
Krtap9-5 T A 11: 99,948,763 C97S unknown Het
Mapk10 T A 5: 102,991,857 probably benign Het
Mybphl A G 3: 108,365,003 T3A probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Oca2 A G 7: 56,316,393 I378V probably damaging Het
Olfr1355 T A 10: 78,879,683 C170* probably null Het
Pax6 C A 2: 105,680,301 Q2K probably benign Het
Plxna2 C A 1: 194,780,510 probably null Het
Ppp1r13b A G 12: 111,835,116 L378P probably damaging Het
Prkdc G A 16: 15,752,782 E2310K probably damaging Het
Pth2r G A 1: 65,372,348 G348E possibly damaging Het
Rarb T C 14: 16,436,769 I251V probably damaging Het
Rasa2 A G 9: 96,552,323 L637P probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Syt1 A T 10: 108,636,662 D120E probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmbim1 A G 1: 74,290,746 probably benign Het
Tnfrsf25 G A 4: 152,118,288 C191Y probably damaging Het
Tnn T C 1: 160,125,398 K691E probably damaging Het
Trim7 T A 11: 48,837,819 V98E probably damaging Het
Tspan3 A G 9: 56,160,820 F15L probably benign Het
Uap1l1 A G 2: 25,362,747 L427S probably damaging Het
Upf1 A C 8: 70,338,403 M574R probably damaging Het
Ush2a T A 1: 188,550,207 V1931E probably benign Het
Zfp3 T C 11: 70,772,585 S457P probably damaging Het
Other mutations in Kpna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Kpna6 APN 4 129655483 missense probably damaging 1.00
IGL02750:Kpna6 APN 4 129661377 missense probably damaging 1.00
IGL02904:Kpna6 APN 4 129650687 missense probably benign 0.24
IGL02998:Kpna6 APN 4 129655504 missense probably benign 0.00
IGL03370:Kpna6 APN 4 129655521 missense probably damaging 1.00
krazy_eight UTSW 4 129655428 critical splice donor site probably null
magnificent_seven UTSW 4 129649306 nonsense probably null
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0305:Kpna6 UTSW 4 129649249 missense probably benign 0.00
R0390:Kpna6 UTSW 4 129657804 missense possibly damaging 0.61
R0623:Kpna6 UTSW 4 129655416 unclassified probably benign
R0646:Kpna6 UTSW 4 129650790 missense probably benign 0.43
R1348:Kpna6 UTSW 4 129661359 nonsense probably null
R1661:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1665:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1766:Kpna6 UTSW 4 129657442 missense probably benign 0.33
R4833:Kpna6 UTSW 4 129657779 missense possibly damaging 0.51
R4941:Kpna6 UTSW 4 129648032 missense probably damaging 1.00
R4974:Kpna6 UTSW 4 129656405 splice site probably null
R5244:Kpna6 UTSW 4 129655428 critical splice donor site probably null
R5914:Kpna6 UTSW 4 129672692 unclassified probably benign
R6148:Kpna6 UTSW 4 129649306 nonsense probably null
R6713:Kpna6 UTSW 4 129653984 missense probably damaging 1.00
R6799:Kpna6 UTSW 4 129657454 missense probably damaging 0.99
R6942:Kpna6 UTSW 4 129651721 splice site probably null
R7073:Kpna6 UTSW 4 129654346 missense probably damaging 1.00
R7794:Kpna6 UTSW 4 129648051 missense probably benign
R7815:Kpna6 UTSW 4 129657797 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTCAAAACCCAATGTGAGCCTC -3'
(R):5'- TCCCACTGCTTTTGGTTGGGAAC -3'

Sequencing Primer
(F):5'- CCCAATGTGAGCCTCAGATG -3'
(R):5'- TTGGGAACTTGTACTTCAGGAAAG -3'
Posted On2013-11-18