Incidental Mutation 'R1067:G3bp2'
ID 86044
Institutional Source Beutler Lab
Gene Symbol G3bp2
Ensembl Gene ENSMUSG00000029405
Gene Name GTPase activating protein (SH3 domain) binding protein 2
Synonyms G3BP, E430034L04Rik, G3BP2
MMRRC Submission 039153-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1067 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 92052146-92083719 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 92063328 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113127] [ENSMUST00000164378] [ENSMUST00000167918] [ENSMUST00000169094] [ENSMUST00000201820] [ENSMUST00000202123] [ENSMUST00000202258]
AlphaFold P97379
Predicted Effect probably benign
Transcript: ENSMUST00000113127
SMART Domains Protein: ENSMUSP00000108752
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164378
SMART Domains Protein: ENSMUSP00000128353
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167918
SMART Domains Protein: ENSMUSP00000132469
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169094
SMART Domains Protein: ENSMUSP00000128244
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 1.1e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201820
SMART Domains Protein: ENSMUSP00000144404
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 117 9.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201824
Predicted Effect probably benign
Transcript: ENSMUST00000202123
SMART Domains Protein: ENSMUSP00000143804
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202258
SMART Domains Protein: ENSMUSP00000144456
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202352
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,823,947 probably benign Het
Adam24 T A 8: 40,680,754 C420* probably null Het
Atp12a G A 14: 56,373,436 G346S probably damaging Het
Bpifa3 A T 2: 154,137,609 Q218L probably damaging Het
Cntrl T C 2: 35,149,022 probably benign Het
Defb41 A G 1: 18,265,024 probably null Het
Edc4 C A 8: 105,891,005 T1094K probably damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
Herc6 T A 6: 57,662,219 N888K probably damaging Het
Iqgap1 G A 7: 80,723,828 T1471M probably benign Het
Kpna6 G T 4: 129,648,103 H500Q probably benign Het
Krt78 G A 15: 101,946,461 Q972* probably null Het
Krtap9-5 T A 11: 99,948,763 C97S unknown Het
Mapk10 T A 5: 102,991,857 probably benign Het
Mybphl A G 3: 108,365,003 T3A probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Oca2 A G 7: 56,316,393 I378V probably damaging Het
Olfr1355 T A 10: 78,879,683 C170* probably null Het
Pax6 C A 2: 105,680,301 Q2K probably benign Het
Plxna2 C A 1: 194,780,510 probably null Het
Ppp1r13b A G 12: 111,835,116 L378P probably damaging Het
Prkdc G A 16: 15,752,782 E2310K probably damaging Het
Pth2r G A 1: 65,372,348 G348E possibly damaging Het
Rarb T C 14: 16,436,769 I251V probably damaging Het
Rasa2 A G 9: 96,552,323 L637P probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Syt1 A T 10: 108,636,662 D120E probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmbim1 A G 1: 74,290,746 probably benign Het
Tnfrsf25 G A 4: 152,118,288 C191Y probably damaging Het
Tnn T C 1: 160,125,398 K691E probably damaging Het
Trim7 T A 11: 48,837,819 V98E probably damaging Het
Tspan3 A G 9: 56,160,820 F15L probably benign Het
Uap1l1 A G 2: 25,362,747 L427S probably damaging Het
Upf1 A C 8: 70,338,403 M574R probably damaging Het
Ush2a T A 1: 188,550,207 V1931E probably benign Het
Zfp3 T C 11: 70,772,585 S457P probably damaging Het
Other mutations in G3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:G3bp2 APN 5 92065848 missense probably damaging 0.98
IGL02124:G3bp2 APN 5 92073247 missense possibly damaging 0.92
IGL02519:G3bp2 APN 5 92066524 missense possibly damaging 0.90
IGL03146:G3bp2 APN 5 92066540 missense probably damaging 1.00
IGL03183:G3bp2 APN 5 92055046 missense possibly damaging 0.82
IGL03195:G3bp2 APN 5 92068508 splice site probably benign
IGL03385:G3bp2 APN 5 92068395 missense probably damaging 1.00
R0558:G3bp2 UTSW 5 92073197 missense probably damaging 1.00
R1621:G3bp2 UTSW 5 92056278 missense probably damaging 1.00
R2294:G3bp2 UTSW 5 92058028 missense probably damaging 1.00
R3698:G3bp2 UTSW 5 92056280 missense possibly damaging 0.91
R4159:G3bp2 UTSW 5 92064401 missense probably benign 0.00
R4195:G3bp2 UTSW 5 92055416 missense probably damaging 0.99
R4754:G3bp2 UTSW 5 92054909 missense possibly damaging 0.85
R5518:G3bp2 UTSW 5 92068488 missense probably benign 0.00
R5680:G3bp2 UTSW 5 92068360 missense probably damaging 1.00
R5937:G3bp2 UTSW 5 92055397 missense probably damaging 1.00
R8769:G3bp2 UTSW 5 92083497 intron probably benign
R8945:G3bp2 UTSW 5 92068422 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCAATCAAACTGTGTCAAACACTC -3'
(R):5'- AGTTGAGACAAAACAGCAGTCGTACC -3'

Sequencing Primer
(F):5'- GCCTAAAATACTCTTGCTAAGTGG -3'
(R):5'- TTCTGAAAGTTGGCACACAGAC -3'
Posted On 2013-11-18