Mutagenetix > Incidental Mutation

Incidental Mutation 'R1067:Upf1'

86051

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

039153-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R1067 (G1)

Quality Score

153

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 70338403 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 574 (M574R)

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: M574R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: M574R

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215817
AA Change: M563R

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.0914

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 94.7%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim3	A	G	18: 61,823,947		probably benign	Het
Adam24	T	A	8: 40,680,754	C420*	probably null	Het
Atp12a	G	A	14: 56,373,436	G346S	probably damaging	Het
Bpifa3	A	T	2: 154,137,609	Q218L	probably damaging	Het
Cntrl	T	C	2: 35,149,022		probably benign	Het
Defb41	A	G	1: 18,265,024		probably null	Het
Edc4	C	A	8: 105,891,005	T1094K	probably damaging	Het
Exoc4	T	A	6: 33,918,424	I792N	possibly damaging	Het
G3bp2	A	T	5: 92,063,328		probably benign	Het
Herc6	T	A	6: 57,662,219	N888K	probably damaging	Het
Iqgap1	G	A	7: 80,723,828	T1471M	probably benign	Het
Kpna6	G	T	4: 129,648,103	H500Q	probably benign	Het
Krt78	G	A	15: 101,946,461	Q972*	probably null	Het
Krtap9-5	T	A	11: 99,948,763	C97S	unknown	Het
Mapk10	T	A	5: 102,991,857		probably benign	Het
Mybphl	A	G	3: 108,365,003	T3A	probably benign	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Oca2	A	G	7: 56,316,393	I378V	probably damaging	Het
Olfr1355	T	A	10: 78,879,683	C170*	probably null	Het
Pax6	C	A	2: 105,680,301	Q2K	probably benign	Het
Plxna2	C	A	1: 194,780,510		probably null	Het
Ppp1r13b	A	G	12: 111,835,116	L378P	probably damaging	Het
Prkdc	G	A	16: 15,752,782	E2310K	probably damaging	Het
Pth2r	G	A	1: 65,372,348	G348E	possibly damaging	Het
Rarb	T	C	14: 16,436,769	I251V	probably damaging	Het
Rasa2	A	G	9: 96,552,323	L637P	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Syt1	A	T	10: 108,636,662	D120E	probably benign	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tmbim1	A	G	1: 74,290,746		probably benign	Het
Tnfrsf25	G	A	4: 152,118,288	C191Y	probably damaging	Het
Tnn	T	C	1: 160,125,398	K691E	probably damaging	Het
Trim7	T	A	11: 48,837,819	V98E	probably damaging	Het
Tspan3	A	G	9: 56,160,820	F15L	probably benign	Het
Uap1l1	A	G	2: 25,362,747	L427S	probably damaging	Het
Ush2a	T	A	1: 188,550,207	V1931E	probably benign	Het
Zfp3	T	C	11: 70,772,585	S457P	probably damaging	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACCAGGCTTCTGACTCGAACAGAC -3'
(R):5'- TTGTGCTCCAAGTAACATCGCTGTG -3'

Sequencing Primer
(F):5'- ACCATGAGAAGTTCTCTCTCAG -3'
(R):5'- TAACATCGCTGTGGACCAG -3'

Posted On

2013-11-18