Incidental Mutation 'R1067:Trim7'
ID86058
Institutional Source Beutler Lab
Gene Symbol Trim7
Ensembl Gene ENSMUSG00000040350
Gene Nametripartite motif-containing 7
Synonyms
MMRRC Submission 039153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1067 (G1)
Quality Score111
Status Validated
Chromosome11
Chromosomal Location48826140-48852209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48837819 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 98 (V98E)
Ref Sequence ENSEMBL: ENSMUSP00000118669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046903] [ENSMUST00000109213] [ENSMUST00000129674] [ENSMUST00000149049] [ENSMUST00000155478]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046903
AA Change: V98E

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039011
Gene: ENSMUSG00000040350
AA Change: V98E

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 246 271 N/A INTRINSIC
low complexity region 285 304 N/A INTRINSIC
PRY 340 392 4.61e-18 SMART
SPRY 393 506 1.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109213
SMART Domains Protein: ENSMUSP00000104836
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
coiled coil region 39 64 N/A INTRINSIC
low complexity region 78 97 N/A INTRINSIC
PRY 133 185 4.61e-18 SMART
SPRY 186 299 1.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129674
SMART Domains Protein: ENSMUSP00000116067
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149049
Predicted Effect probably damaging
Transcript: ENSMUST00000155478
AA Change: V98E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118669
Gene: ENSMUSG00000040350
AA Change: V98E

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 221 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216796
Meta Mutation Damage Score 0.2876 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,823,947 probably benign Het
Adam24 T A 8: 40,680,754 C420* probably null Het
Atp12a G A 14: 56,373,436 G346S probably damaging Het
Bpifa3 A T 2: 154,137,609 Q218L probably damaging Het
Cntrl T C 2: 35,149,022 probably benign Het
Defb41 A G 1: 18,265,024 probably null Het
Edc4 C A 8: 105,891,005 T1094K probably damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
G3bp2 A T 5: 92,063,328 probably benign Het
Herc6 T A 6: 57,662,219 N888K probably damaging Het
Iqgap1 G A 7: 80,723,828 T1471M probably benign Het
Kpna6 G T 4: 129,648,103 H500Q probably benign Het
Krt78 G A 15: 101,946,461 Q972* probably null Het
Krtap9-5 T A 11: 99,948,763 C97S unknown Het
Mapk10 T A 5: 102,991,857 probably benign Het
Mybphl A G 3: 108,365,003 T3A probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Oca2 A G 7: 56,316,393 I378V probably damaging Het
Olfr1355 T A 10: 78,879,683 C170* probably null Het
Pax6 C A 2: 105,680,301 Q2K probably benign Het
Plxna2 C A 1: 194,780,510 probably null Het
Ppp1r13b A G 12: 111,835,116 L378P probably damaging Het
Prkdc G A 16: 15,752,782 E2310K probably damaging Het
Pth2r G A 1: 65,372,348 G348E possibly damaging Het
Rarb T C 14: 16,436,769 I251V probably damaging Het
Rasa2 A G 9: 96,552,323 L637P probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Syt1 A T 10: 108,636,662 D120E probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmbim1 A G 1: 74,290,746 probably benign Het
Tnfrsf25 G A 4: 152,118,288 C191Y probably damaging Het
Tnn T C 1: 160,125,398 K691E probably damaging Het
Tspan3 A G 9: 56,160,820 F15L probably benign Het
Uap1l1 A G 2: 25,362,747 L427S probably damaging Het
Upf1 A C 8: 70,338,403 M574R probably damaging Het
Ush2a T A 1: 188,550,207 V1931E probably benign Het
Zfp3 T C 11: 70,772,585 S457P probably damaging Het
Other mutations in Trim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trim7 APN 11 48845571 missense probably damaging 0.99
IGL00476:Trim7 APN 11 48848078 missense probably benign 0.39
R0119:Trim7 UTSW 11 48849712 missense probably damaging 1.00
R0308:Trim7 UTSW 11 48849501 missense probably damaging 0.96
R0546:Trim7 UTSW 11 48845509 missense probably damaging 1.00
R1081:Trim7 UTSW 11 48849705 missense probably damaging 1.00
R2139:Trim7 UTSW 11 48838894 missense probably benign 0.06
R3796:Trim7 UTSW 11 48845670 splice site probably null
R3797:Trim7 UTSW 11 48845670 splice site probably null
R3901:Trim7 UTSW 11 48837608 missense probably damaging 0.98
R4157:Trim7 UTSW 11 48848093 missense probably benign 0.00
R4603:Trim7 UTSW 11 48837528 start codon destroyed probably null 0.98
R5429:Trim7 UTSW 11 48849955 missense probably damaging 1.00
R5915:Trim7 UTSW 11 48845650 missense possibly damaging 0.95
R5988:Trim7 UTSW 11 48837686 missense probably benign 0.01
R7960:Trim7 UTSW 11 48837801 missense probably damaging 0.99
R8100:Trim7 UTSW 11 48849519 missense probably damaging 1.00
Z1176:Trim7 UTSW 11 48849893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTCTGCCGAGCCTGTATTATG -3'
(R):5'- GTTACATTAGCGGTTGGGGACAGAC -3'

Sequencing Primer
(F):5'- AGCCTGTATTATGCGCTGC -3'
(R):5'- AGACAAGATTTCAAGTCCCTGG -3'
Posted On2013-11-18