Incidental Mutation 'R1067:Tedc2'
ID86069
Institutional Source Beutler Lab
Gene Symbol Tedc2
Ensembl Gene ENSMUSG00000024118
Gene Nametubulin epsilon and delta complex 2
Synonyms1600002H07Rik
MMRRC Submission 039153-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R1067 (G1)
Quality Score90
Status Validated
Chromosome17
Chromosomal Location24215054-24220851 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 24216318 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 366 (E366*)
Ref Sequence ENSEMBL: ENSMUSP00000024930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024930]
Predicted Effect probably null
Transcript: ENSMUST00000024930
AA Change: E366*
SMART Domains Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118
AA Change: E366*

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
low complexity region 78 84 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
Pfam:DUF4693 150 434 8.6e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124557
SMART Domains Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171563
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,823,947 probably benign Het
Adam24 T A 8: 40,680,754 C420* probably null Het
Atp12a G A 14: 56,373,436 G346S probably damaging Het
Bpifa3 A T 2: 154,137,609 Q218L probably damaging Het
Cntrl T C 2: 35,149,022 probably benign Het
Defb41 A G 1: 18,265,024 probably null Het
Edc4 C A 8: 105,891,005 T1094K probably damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
G3bp2 A T 5: 92,063,328 probably benign Het
Herc6 T A 6: 57,662,219 N888K probably damaging Het
Iqgap1 G A 7: 80,723,828 T1471M probably benign Het
Kpna6 G T 4: 129,648,103 H500Q probably benign Het
Krt78 G A 15: 101,946,461 Q972* probably null Het
Krtap9-5 T A 11: 99,948,763 C97S unknown Het
Mapk10 T A 5: 102,991,857 probably benign Het
Mybphl A G 3: 108,365,003 T3A probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Oca2 A G 7: 56,316,393 I378V probably damaging Het
Olfr1355 T A 10: 78,879,683 C170* probably null Het
Pax6 C A 2: 105,680,301 Q2K probably benign Het
Plxna2 C A 1: 194,780,510 probably null Het
Ppp1r13b A G 12: 111,835,116 L378P probably damaging Het
Prkdc G A 16: 15,752,782 E2310K probably damaging Het
Pth2r G A 1: 65,372,348 G348E possibly damaging Het
Rarb T C 14: 16,436,769 I251V probably damaging Het
Rasa2 A G 9: 96,552,323 L637P probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Syt1 A T 10: 108,636,662 D120E probably benign Het
Tmbim1 A G 1: 74,290,746 probably benign Het
Tnfrsf25 G A 4: 152,118,288 C191Y probably damaging Het
Tnn T C 1: 160,125,398 K691E probably damaging Het
Trim7 T A 11: 48,837,819 V98E probably damaging Het
Tspan3 A G 9: 56,160,820 F15L probably benign Het
Uap1l1 A G 2: 25,362,747 L427S probably damaging Het
Upf1 A C 8: 70,338,403 M574R probably damaging Het
Ush2a T A 1: 188,550,207 V1931E probably benign Het
Zfp3 T C 11: 70,772,585 S457P probably damaging Het
Other mutations in Tedc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Tedc2 APN 17 24217952 missense probably benign 0.01
IGL02111:Tedc2 APN 17 24218166 splice site probably benign
IGL02347:Tedc2 APN 17 24220610 missense probably damaging 1.00
IGL03400:Tedc2 APN 17 24219803 missense probably benign
R0766:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R0766:Tedc2 UTSW 17 24216318 nonsense probably null
R1066:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1066:Tedc2 UTSW 17 24216318 nonsense probably null
R1067:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1085:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1085:Tedc2 UTSW 17 24216318 nonsense probably null
R1086:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1086:Tedc2 UTSW 17 24216318 nonsense probably null
R1136:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1136:Tedc2 UTSW 17 24216318 nonsense probably null
R1137:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1137:Tedc2 UTSW 17 24216318 nonsense probably null
R1203:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1203:Tedc2 UTSW 17 24216318 nonsense probably null
R1345:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1345:Tedc2 UTSW 17 24216318 nonsense probably null
R1385:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1385:Tedc2 UTSW 17 24216318 nonsense probably null
R1396:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1396:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1891:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1891:Tedc2 UTSW 17 24216318 nonsense probably null
R1943:Tedc2 UTSW 17 24217949 missense possibly damaging 0.90
R1984:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1984:Tedc2 UTSW 17 24216318 nonsense probably null
R1985:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1985:Tedc2 UTSW 17 24216318 nonsense probably null
R1986:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1986:Tedc2 UTSW 17 24216318 nonsense probably null
R2026:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2026:Tedc2 UTSW 17 24216318 nonsense probably null
R2054:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2054:Tedc2 UTSW 17 24216318 nonsense probably null
R2086:Tedc2 UTSW 17 24217900 missense probably damaging 1.00
R2317:Tedc2 UTSW 17 24216384 missense probably benign 0.00
R3705:Tedc2 UTSW 17 24216387 missense probably benign 0.30
R4085:Tedc2 UTSW 17 24219839 missense probably benign 0.01
R4664:Tedc2 UTSW 17 24220140 splice site probably benign
R4676:Tedc2 UTSW 17 24220011 missense probably benign
R4686:Tedc2 UTSW 17 24217888 critical splice donor site probably null
R4762:Tedc2 UTSW 17 24216380 missense probably benign 0.05
R4837:Tedc2 UTSW 17 24220593 missense probably damaging 1.00
R4863:Tedc2 UTSW 17 24217936 missense probably damaging 1.00
R5936:Tedc2 UTSW 17 24216341 missense probably damaging 1.00
RF031:Tedc2 UTSW 17 24216239 critical splice donor site probably benign
Z1177:Tedc2 UTSW 17 24220571 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCTACTGCTTCTCCCGAGACTTAC -3'
(R):5'- TGCATACTACGGGCTGCTACACAC -3'

Sequencing Primer
(F):5'- TCCCGAGACTTACCCTGG -3'
(R):5'- ctgcctgcctctgcctc -3'
Posted On2013-11-18