Incidental Mutation 'R1068:Nop2'
ID86085
Institutional Source Beutler Lab
Gene Symbol Nop2
Ensembl Gene ENSMUSG00000038279
Gene NameNOP2 nucleolar protein
Synonyms120kDa, Nol1
MMRRC Submission 039154-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1068 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125131909-125144753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125132279 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 23 (K23E)
Ref Sequence ENSEMBL: ENSMUSP00000145333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000204185]
Predicted Effect probably damaging
Transcript: ENSMUST00000044200
AA Change: K23E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279
AA Change: K23E

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
Pfam:Methyltr_RsmF_N 268 359 2.9e-12 PFAM
Pfam:Nol1_Nop2_Fmu 362 570 2e-86 PFAM
Pfam:P120R 609 630 2.7e-11 PFAM
Pfam:P120R 663 685 1.1e-12 PFAM
low complexity region 729 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056889
SMART Domains Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 7.7e-35 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 365 408 7.17e-15 SMART
RING 366 407 7.46e-1 SMART
low complexity region 424 443 N/A INTRINSIC
PHD 444 487 4.41e-15 SMART
RING 445 486 2.63e0 SMART
CHROMO 492 572 8.11e-17 SMART
CHROMO 613 670 1.98e-11 SMART
low complexity region 675 694 N/A INTRINSIC
DEXDc 715 927 2.73e-37 SMART
low complexity region 1044 1056 N/A INTRINSIC
HELICc 1073 1157 7.61e-27 SMART
DUF1087 1282 1346 5.56e-33 SMART
DUF1086 1359 1516 4.05e-108 SMART
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1590 1633 N/A INTRINSIC
low complexity region 1635 1653 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
Pfam:CHDCT2 1727 1899 1.9e-98 PFAM
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112390
SMART Domains Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 114 151 N/A INTRINSIC
Pfam:CHDNT 164 217 2e-28 PFAM
low complexity region 224 256 N/A INTRINSIC
low complexity region 278 298 N/A INTRINSIC
low complexity region 303 325 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
PHD 372 415 7.17e-15 SMART
RING 373 414 7.46e-1 SMART
low complexity region 431 450 N/A INTRINSIC
PHD 451 494 4.41e-15 SMART
RING 452 493 2.63e0 SMART
CHROMO 499 579 8.11e-17 SMART
CHROMO 620 677 1.98e-11 SMART
low complexity region 682 701 N/A INTRINSIC
DEXDc 722 934 2.73e-37 SMART
low complexity region 1051 1063 N/A INTRINSIC
HELICc 1080 1164 7.61e-27 SMART
DUF1087 1289 1353 5.56e-33 SMART
DUF1086 1366 1523 4.05e-108 SMART
low complexity region 1533 1547 N/A INTRINSIC
low complexity region 1567 1585 N/A INTRINSIC
low complexity region 1597 1640 N/A INTRINSIC
low complexity region 1642 1660 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
Pfam:CHDCT2 1735 1906 4.3e-90 PFAM
low complexity region 1910 1922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112392
SMART Domains Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 1.1e-34 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 352 395 7.17e-15 SMART
RING 353 394 7.46e-1 SMART
low complexity region 411 430 N/A INTRINSIC
PHD 431 474 4.41e-15 SMART
RING 432 473 2.63e0 SMART
CHROMO 479 559 8.11e-17 SMART
CHROMO 600 657 1.98e-11 SMART
low complexity region 662 681 N/A INTRINSIC
DEXDc 702 914 2.73e-37 SMART
low complexity region 1031 1043 N/A INTRINSIC
HELICc 1060 1144 7.61e-27 SMART
DUF1087 1269 1333 5.56e-33 SMART
DUF1086 1346 1503 4.05e-108 SMART
low complexity region 1513 1527 N/A INTRINSIC
low complexity region 1547 1565 N/A INTRINSIC
low complexity region 1577 1620 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Pfam:CHDCT2 1714 1886 2.8e-98 PFAM
low complexity region 1890 1902 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204185
AA Change: K23E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145333
Gene: ENSMUSG00000038279
AA Change: K23E

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,068 V25E unknown Het
4933416C03Rik C T 10: 116,113,454 V56I probably damaging Het
Acsm4 C A 7: 119,708,710 Q357K probably benign Het
Adam11 T G 11: 102,776,378 L619R probably damaging Het
Ccne2 A G 4: 11,192,850 N17S probably benign Het
Cfap52 T C 11: 67,939,004 H313R probably benign Het
Chsy3 A T 18: 59,410,289 H833L probably damaging Het
Csnk1a1 G T 18: 61,569,563 probably null Het
Cyp2c40 T C 19: 39,812,581 K77E possibly damaging Het
Dmtf1 T C 5: 9,136,109 E159G probably damaging Het
Fat3 C T 9: 15,970,034 V3181I probably benign Het
Gab1 T C 8: 80,800,172 D99G possibly damaging Het
Garem1 T C 18: 21,168,755 E125G probably benign Het
Kcnf1 A G 12: 17,175,474 Y249H probably damaging Het
Kit C T 5: 75,609,518 H197Y probably benign Het
Memo1 T A 17: 74,225,555 I153F probably damaging Het
Myh7 T A 14: 54,987,319 N597I possibly damaging Het
Nxf1 T A 19: 8,762,754 V95E probably damaging Het
Pamr1 T A 2: 102,642,245 C630S probably damaging Het
Ptprh G T 7: 4,549,463 P934Q possibly damaging Het
Ralgapa1 A G 12: 55,790,310 probably null Het
Ralyl T A 3: 13,776,889 N28K probably damaging Het
Rasgrp1 A G 2: 117,282,576 V785A probably benign Het
Rpp30 T A 19: 36,083,738 M1K probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snx19 G A 9: 30,429,018 R484Q probably damaging Het
Speer4a A T 5: 26,036,026 L156Q probably null Het
St18 A G 1: 6,795,562 D88G probably benign Het
Syt7 T C 19: 10,444,011 Y520H probably benign Het
Tle4 C G 19: 14,452,179 W674C probably damaging Het
Tnik T A 3: 28,532,975 Y132N probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps11 A T 9: 44,353,019 L719Q probably damaging Het
Zc3h4 T G 7: 16,429,236 H520Q unknown Het
Zdbf2 C T 1: 63,303,430 R323C possibly damaging Het
Zfp616 T A 11: 74,082,941 *99K probably null Het
Other mutations in Nop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Nop2 APN 6 125133546 missense probably damaging 1.00
IGL00913:Nop2 APN 6 125139821 missense probably damaging 1.00
IGL02568:Nop2 APN 6 125140850 missense probably damaging 1.00
IGL02850:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02850:Nop2 APN 6 125144070 missense probably benign 0.01
IGL02851:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02851:Nop2 APN 6 125144070 missense probably benign 0.01
IGL03144:Nop2 APN 6 125137512 critical splice donor site probably null
IGL03338:Nop2 APN 6 125139732 splice site probably null
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0486:Nop2 UTSW 6 125140673 missense probably null 0.14
R0627:Nop2 UTSW 6 125139704 missense possibly damaging 0.90
R1022:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1024:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1750:Nop2 UTSW 6 125137638 missense probably benign 0.00
R1847:Nop2 UTSW 6 125137079 unclassified probably benign
R1940:Nop2 UTSW 6 125134634 missense probably benign 0.43
R1972:Nop2 UTSW 6 125134639 missense probably benign 0.02
R2059:Nop2 UTSW 6 125139860 missense probably null 0.95
R2100:Nop2 UTSW 6 125140822 missense probably damaging 1.00
R3123:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3124:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3160:Nop2 UTSW 6 125134592 missense probably benign 0.00
R3162:Nop2 UTSW 6 125134592 missense probably benign 0.00
R4521:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4522:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4523:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4524:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4571:Nop2 UTSW 6 125140881 critical splice donor site probably null
R4695:Nop2 UTSW 6 125144556 missense probably benign 0.00
R4747:Nop2 UTSW 6 125137094 missense probably benign
R5010:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5385:Nop2 UTSW 6 125144361 missense probably benign
R5455:Nop2 UTSW 6 125140643 missense probably benign 0.19
R5567:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5914:Nop2 UTSW 6 125134728 missense probably benign 0.01
R5993:Nop2 UTSW 6 125144019 missense probably benign 0.00
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6065:Nop2 UTSW 6 125144565 missense probably benign
R6352:Nop2 UTSW 6 125137207 missense probably benign
R6436:Nop2 UTSW 6 125137311 missense probably benign 0.01
R7393:Nop2 UTSW 6 125133546 nonsense probably null
R7499:Nop2 UTSW 6 125144208 missense possibly damaging 0.75
R8029:Nop2 UTSW 6 125144420 missense possibly damaging 0.77
R8059:Nop2 UTSW 6 125140812 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTCACTTTCGCGGTGTGCGAC -3'
(R):5'- TGAGAACTCCCTTCCTGGAAACGG -3'

Sequencing Primer
(F):5'- GGTGTGCGACCTCTGAG -3'
(R):5'- TTCCTGGAAACGGAAGATCGC -3'
Posted On2013-11-18