Mutagenetix > Incidental Mutation

Incidental Mutation 'R1068:Garem1'

86104

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

MMRRC Submission

039154-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R1068 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21168755 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 125 (E125G)

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably benign
Transcript: ENSMUST00000049260
AA Change: E125G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: E125G

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.6%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930546C10Rik	A	T	18: 68,950,068	V25E	unknown	Het
4933416C03Rik	C	T	10: 116,113,454	V56I	probably damaging	Het
Acsm4	C	A	7: 119,708,710	Q357K	probably benign	Het
Adam11	T	G	11: 102,776,378	L619R	probably damaging	Het
Ccne2	A	G	4: 11,192,850	N17S	probably benign	Het
Cfap52	T	C	11: 67,939,004	H313R	probably benign	Het
Chsy3	A	T	18: 59,410,289	H833L	probably damaging	Het
Csnk1a1	G	T	18: 61,569,563		probably null	Het
Cyp2c40	T	C	19: 39,812,581	K77E	possibly damaging	Het
Dmtf1	T	C	5: 9,136,109	E159G	probably damaging	Het
Fat3	C	T	9: 15,970,034	V3181I	probably benign	Het
Gab1	T	C	8: 80,800,172	D99G	possibly damaging	Het
Kcnf1	A	G	12: 17,175,474	Y249H	probably damaging	Het
Kit	C	T	5: 75,609,518	H197Y	probably benign	Het
Memo1	T	A	17: 74,225,555	I153F	probably damaging	Het
Myh7	T	A	14: 54,987,319	N597I	possibly damaging	Het
Nop2	A	G	6: 125,132,279	K23E	probably damaging	Het
Nxf1	T	A	19: 8,762,754	V95E	probably damaging	Het
Pamr1	T	A	2: 102,642,245	C630S	probably damaging	Het
Ptprh	G	T	7: 4,549,463	P934Q	possibly damaging	Het
Ralgapa1	A	G	12: 55,790,310		probably null	Het
Ralyl	T	A	3: 13,776,889	N28K	probably damaging	Het
Rasgrp1	A	G	2: 117,282,576	V785A	probably benign	Het
Rpp30	T	A	19: 36,083,738	M1K	probably null	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Snx19	G	A	9: 30,429,018	R484Q	probably damaging	Het
Speer4a	A	T	5: 26,036,026	L156Q	probably null	Het
St18	A	G	1: 6,795,562	D88G	probably benign	Het
Syt7	T	C	19: 10,444,011	Y520H	probably benign	Het
Tle4	C	G	19: 14,452,179	W674C	probably damaging	Het
Tnik	T	A	3: 28,532,975	Y132N	probably damaging	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Vps11	A	T	9: 44,353,019	L719Q	probably damaging	Het
Zc3h4	T	G	7: 16,429,236	H520Q	unknown	Het
Zdbf2	C	T	1: 63,303,430	R323C	possibly damaging	Het
Zfp616	T	A	11: 74,082,941	*99K	probably null	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0136:Garem1	UTSW	18	21129991	missense	probably damaging	0.96
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R2140:Garem1	UTSW	18	21129374	missense	probably damaging	1.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4831:Garem1	UTSW	18	21129768	missense	probably benign	0.01
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5963:Garem1	UTSW	18	21129430	missense	probably benign	0.45
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6134:Garem1	UTSW	18	21129824	missense	probably benign	0.00
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6662:Garem1	UTSW	18	21148247	missense	probably benign	0.45
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7534:Garem1	UTSW	18	21299916	start gained	probably benign
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9411:Garem1	UTSW	18	21236000	critical splice donor site	probably null
R9475:Garem1	UTSW	18	21148313	missense	probably benign	0.00
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGTCAGGTGGGCTTTACCACTAAC -3'
(R):5'- TTCCCCTGGGAGGTCTAATGACATGC -3'

Sequencing Primer
(F):5'- GGCTTTACCACTAACAGTGTTTCAG -3'
(R):5'- GGCCCTGATAGTAAGCTCTGAATC -3'

Posted On

2013-11-18