Incidental Mutation 'R1068:Garem1'
ID 86104
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene Name GRB2 associated regulator of MAPK1 subtype 1
Synonyms Garem, Fam59a, LOC381126
MMRRC Submission 039154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock # R1068 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 21127201-21300138 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21168755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 125 (E125G)
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
AlphaFold Q3UFT3
Predicted Effect probably benign
Transcript: ENSMUST00000049260
AA Change: E125G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: E125G

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,068 V25E unknown Het
4933416C03Rik C T 10: 116,113,454 V56I probably damaging Het
Acsm4 C A 7: 119,708,710 Q357K probably benign Het
Adam11 T G 11: 102,776,378 L619R probably damaging Het
Ccne2 A G 4: 11,192,850 N17S probably benign Het
Cfap52 T C 11: 67,939,004 H313R probably benign Het
Chsy3 A T 18: 59,410,289 H833L probably damaging Het
Csnk1a1 G T 18: 61,569,563 probably null Het
Cyp2c40 T C 19: 39,812,581 K77E possibly damaging Het
Dmtf1 T C 5: 9,136,109 E159G probably damaging Het
Fat3 C T 9: 15,970,034 V3181I probably benign Het
Gab1 T C 8: 80,800,172 D99G possibly damaging Het
Kcnf1 A G 12: 17,175,474 Y249H probably damaging Het
Kit C T 5: 75,609,518 H197Y probably benign Het
Memo1 T A 17: 74,225,555 I153F probably damaging Het
Myh7 T A 14: 54,987,319 N597I possibly damaging Het
Nop2 A G 6: 125,132,279 K23E probably damaging Het
Nxf1 T A 19: 8,762,754 V95E probably damaging Het
Pamr1 T A 2: 102,642,245 C630S probably damaging Het
Ptprh G T 7: 4,549,463 P934Q possibly damaging Het
Ralgapa1 A G 12: 55,790,310 probably null Het
Ralyl T A 3: 13,776,889 N28K probably damaging Het
Rasgrp1 A G 2: 117,282,576 V785A probably benign Het
Rpp30 T A 19: 36,083,738 M1K probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snx19 G A 9: 30,429,018 R484Q probably damaging Het
Speer4a A T 5: 26,036,026 L156Q probably null Het
St18 A G 1: 6,795,562 D88G probably benign Het
Syt7 T C 19: 10,444,011 Y520H probably benign Het
Tle4 C G 19: 14,452,179 W674C probably damaging Het
Tnik T A 3: 28,532,975 Y132N probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps11 A T 9: 44,353,019 L719Q probably damaging Het
Zc3h4 T G 7: 16,429,236 H520Q unknown Het
Zdbf2 C T 1: 63,303,430 R323C possibly damaging Het
Zfp616 T A 11: 74,082,941 *99K probably null Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21148657 missense probably damaging 1.00
IGL01588:Garem1 APN 18 21129797 missense probably damaging 0.99
IGL02171:Garem1 APN 18 21129241 missense probably damaging 0.98
IGL02270:Garem1 APN 18 21148450 missense probably damaging 1.00
IGL03149:Garem1 APN 18 21131466 missense probably damaging 1.00
R0136:Garem1 UTSW 18 21129991 missense probably damaging 0.96
R0285:Garem1 UTSW 18 21129612 missense probably benign
R0361:Garem1 UTSW 18 21299744 nonsense probably null
R1537:Garem1 UTSW 18 21168874 splice site probably null
R1726:Garem1 UTSW 18 21148262 missense probably damaging 0.99
R1826:Garem1 UTSW 18 21129452 missense probably benign 0.00
R2140:Garem1 UTSW 18 21129374 missense probably damaging 1.00
R3714:Garem1 UTSW 18 21148890 missense probably damaging 1.00
R3937:Garem1 UTSW 18 21148806 nonsense probably null
R4362:Garem1 UTSW 18 21236115 missense possibly damaging 0.62
R4441:Garem1 UTSW 18 21168750 missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21129943 missense probably benign
R4814:Garem1 UTSW 18 21148116 missense probably damaging 1.00
R4831:Garem1 UTSW 18 21129768 missense probably benign 0.01
R4838:Garem1 UTSW 18 21147893 missense probably benign 0.00
R5805:Garem1 UTSW 18 21148435 missense probably benign 0.04
R5963:Garem1 UTSW 18 21129430 missense probably benign 0.45
R5982:Garem1 UTSW 18 21148351 missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21129824 missense probably benign 0.00
R6242:Garem1 UTSW 18 21129172 missense possibly damaging 0.72
R6453:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6485:Garem1 UTSW 18 21129837 missense probably benign 0.00
R6596:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6662:Garem1 UTSW 18 21148247 missense probably benign 0.45
R6883:Garem1 UTSW 18 21129712 missense probably benign
R6937:Garem1 UTSW 18 21147770 missense probably benign 0.00
R7027:Garem1 UTSW 18 21129994 missense probably benign
R7256:Garem1 UTSW 18 21148754 missense probably damaging 1.00
R7534:Garem1 UTSW 18 21299916 start gained probably benign
R7620:Garem1 UTSW 18 21129841 missense probably benign
R7869:Garem1 UTSW 18 21299700 missense probably damaging 1.00
R7963:Garem1 UTSW 18 21148787 missense probably damaging 0.98
R8058:Garem1 UTSW 18 21148564 missense probably damaging 1.00
R8953:Garem1 UTSW 18 21131331 critical splice donor site probably null
R9273:Garem1 UTSW 18 21148217 missense probably damaging 0.99
R9411:Garem1 UTSW 18 21236000 critical splice donor site probably null
R9475:Garem1 UTSW 18 21148313 missense probably benign 0.00
Z1176:Garem1 UTSW 18 21129792 missense probably damaging 1.00
Z1176:Garem1 UTSW 18 21148325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTCAGGTGGGCTTTACCACTAAC -3'
(R):5'- TTCCCCTGGGAGGTCTAATGACATGC -3'

Sequencing Primer
(F):5'- GGCTTTACCACTAACAGTGTTTCAG -3'
(R):5'- GGCCCTGATAGTAAGCTCTGAATC -3'
Posted On 2013-11-18