Incidental Mutation 'R1068:Rpp30'
ID86111
Institutional Source Beutler Lab
Gene Symbol Rpp30
Ensembl Gene ENSMUSG00000024800
Gene Nameribonuclease P/MRP 30 subunit
SynonymsTSG15, Rnasep2
MMRRC Submission 039154-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R1068 (G1)
Quality Score206
Status Not validated
Chromosome19
Chromosomal Location36083716-36104772 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 36083738 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000025714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025714]
Predicted Effect probably null
Transcript: ENSMUST00000025714
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025714
Gene: ENSMUSG00000024800
AA Change: M1K

DomainStartEndE-ValueType
Pfam:RNase_P_p30 5 224 4.2e-66 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,068 V25E unknown Het
4933416C03Rik C T 10: 116,113,454 V56I probably damaging Het
Acsm4 C A 7: 119,708,710 Q357K probably benign Het
Adam11 T G 11: 102,776,378 L619R probably damaging Het
Ccne2 A G 4: 11,192,850 N17S probably benign Het
Cfap52 T C 11: 67,939,004 H313R probably benign Het
Chsy3 A T 18: 59,410,289 H833L probably damaging Het
Csnk1a1 G T 18: 61,569,563 probably null Het
Cyp2c40 T C 19: 39,812,581 K77E possibly damaging Het
Dmtf1 T C 5: 9,136,109 E159G probably damaging Het
Fat3 C T 9: 15,970,034 V3181I probably benign Het
Gab1 T C 8: 80,800,172 D99G possibly damaging Het
Garem1 T C 18: 21,168,755 E125G probably benign Het
Kcnf1 A G 12: 17,175,474 Y249H probably damaging Het
Kit C T 5: 75,609,518 H197Y probably benign Het
Memo1 T A 17: 74,225,555 I153F probably damaging Het
Myh7 T A 14: 54,987,319 N597I possibly damaging Het
Nop2 A G 6: 125,132,279 K23E probably damaging Het
Nxf1 T A 19: 8,762,754 V95E probably damaging Het
Pamr1 T A 2: 102,642,245 C630S probably damaging Het
Ptprh G T 7: 4,549,463 P934Q possibly damaging Het
Ralgapa1 A G 12: 55,790,310 probably null Het
Ralyl T A 3: 13,776,889 N28K probably damaging Het
Rasgrp1 A G 2: 117,282,576 V785A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snx19 G A 9: 30,429,018 R484Q probably damaging Het
Speer4a A T 5: 26,036,026 L156Q probably null Het
St18 A G 1: 6,795,562 D88G probably benign Het
Syt7 T C 19: 10,444,011 Y520H probably benign Het
Tle4 C G 19: 14,452,179 W674C probably damaging Het
Tnik T A 3: 28,532,975 Y132N probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps11 A T 9: 44,353,019 L719Q probably damaging Het
Zc3h4 T G 7: 16,429,236 H520Q unknown Het
Zdbf2 C T 1: 63,303,430 R323C possibly damaging Het
Zfp616 T A 11: 74,082,941 *99K probably null Het
Other mutations in Rpp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0271:Rpp30 UTSW 19 36104403 missense probably benign
R1375:Rpp30 UTSW 19 36101273 critical splice donor site probably null
R1521:Rpp30 UTSW 19 36094385 missense possibly damaging 0.95
R1720:Rpp30 UTSW 19 36094427 missense probably damaging 1.00
R1872:Rpp30 UTSW 19 36087393 missense probably benign 0.03
R1965:Rpp30 UTSW 19 36089149 missense probably damaging 1.00
R1966:Rpp30 UTSW 19 36089149 missense probably damaging 1.00
R4412:Rpp30 UTSW 19 36100255 missense possibly damaging 0.95
R5576:Rpp30 UTSW 19 36101851 missense probably benign 0.00
R5633:Rpp30 UTSW 19 36086990 missense probably damaging 1.00
R6293:Rpp30 UTSW 19 36104445 makesense probably null
R7437:Rpp30 UTSW 19 36104438 missense possibly damaging 0.92
R7699:Rpp30 UTSW 19 36089158 missense probably benign 0.00
R7700:Rpp30 UTSW 19 36089158 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGAAAGTCTCTGCAAGACGACCC -3'
(R):5'- TTGTCAAGAGCCCGAGTTTCTCACC -3'

Sequencing Primer
(F):5'- GACGACCCAAGACGACTGAG -3'
(R):5'- ATTCTCTGCCTTTAGGGACG -3'
Posted On2013-11-18