Incidental Mutation 'R1068:Cyp2c40'
ID86112
Institutional Source Beutler Lab
Gene Symbol Cyp2c40
Ensembl Gene ENSMUSG00000025004
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 40
Synonyms
MMRRC Submission 039154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1068 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location39767071-39812814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39812581 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 77 (K77E)
Ref Sequence ENSEMBL: ENSMUSP00000125217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160476] [ENSMUST00000162507] [ENSMUST00000162630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160476
AA Change: K77E

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125217
Gene: ENSMUSG00000025004
AA Change: K77E

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 516 9.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162434
Predicted Effect possibly damaging
Transcript: ENSMUST00000162507
AA Change: K48E

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124618
Gene: ENSMUSG00000025004
AA Change: K48E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 120 3.1e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162630
AA Change: K77E

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123884
Gene: ENSMUSG00000025004
AA Change: K77E

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 193 6.6e-33 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,068 V25E unknown Het
4933416C03Rik C T 10: 116,113,454 V56I probably damaging Het
Acsm4 C A 7: 119,708,710 Q357K probably benign Het
Adam11 T G 11: 102,776,378 L619R probably damaging Het
Ccne2 A G 4: 11,192,850 N17S probably benign Het
Cfap52 T C 11: 67,939,004 H313R probably benign Het
Chsy3 A T 18: 59,410,289 H833L probably damaging Het
Csnk1a1 G T 18: 61,569,563 probably null Het
Dmtf1 T C 5: 9,136,109 E159G probably damaging Het
Fat3 C T 9: 15,970,034 V3181I probably benign Het
Gab1 T C 8: 80,800,172 D99G possibly damaging Het
Garem1 T C 18: 21,168,755 E125G probably benign Het
Kcnf1 A G 12: 17,175,474 Y249H probably damaging Het
Kit C T 5: 75,609,518 H197Y probably benign Het
Memo1 T A 17: 74,225,555 I153F probably damaging Het
Myh7 T A 14: 54,987,319 N597I possibly damaging Het
Nop2 A G 6: 125,132,279 K23E probably damaging Het
Nxf1 T A 19: 8,762,754 V95E probably damaging Het
Pamr1 T A 2: 102,642,245 C630S probably damaging Het
Ptprh G T 7: 4,549,463 P934Q possibly damaging Het
Ralgapa1 A G 12: 55,790,310 probably null Het
Ralyl T A 3: 13,776,889 N28K probably damaging Het
Rasgrp1 A G 2: 117,282,576 V785A probably benign Het
Rpp30 T A 19: 36,083,738 M1K probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snx19 G A 9: 30,429,018 R484Q probably damaging Het
Speer4a A T 5: 26,036,026 L156Q probably null Het
St18 A G 1: 6,795,562 D88G probably benign Het
Syt7 T C 19: 10,444,011 Y520H probably benign Het
Tle4 C G 19: 14,452,179 W674C probably damaging Het
Tnik T A 3: 28,532,975 Y132N probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps11 A T 9: 44,353,019 L719Q probably damaging Het
Zc3h4 T G 7: 16,429,236 H520Q unknown Het
Zdbf2 C T 1: 63,303,430 R323C possibly damaging Het
Zfp616 T A 11: 74,082,941 *99K probably null Het
Other mutations in Cyp2c40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Cyp2c40 APN 19 39812583 missense probably benign 0.17
IGL01660:Cyp2c40 APN 19 39786810 missense probably damaging 0.99
IGL01897:Cyp2c40 APN 19 39803773 nonsense probably null
IGL01926:Cyp2c40 APN 19 39802655 missense probably benign 0.25
IGL02078:Cyp2c40 APN 19 39767482 missense probably benign 0.01
IGL02259:Cyp2c40 APN 19 39803802 missense probably benign 0.00
IGL02716:Cyp2c40 APN 19 39807536 missense possibly damaging 0.49
R0269:Cyp2c40 UTSW 19 39773896 missense probably damaging 1.00
R0308:Cyp2c40 UTSW 19 39777988 missense probably damaging 1.00
R0309:Cyp2c40 UTSW 19 39778051 missense possibly damaging 0.51
R0441:Cyp2c40 UTSW 19 39807163 splice site probably benign
R1123:Cyp2c40 UTSW 19 39812677 missense probably benign 0.00
R1443:Cyp2c40 UTSW 19 39777971 missense possibly damaging 0.90
R1506:Cyp2c40 UTSW 19 39777999 missense probably damaging 0.96
R1567:Cyp2c40 UTSW 19 39803771 missense probably null 0.99
R1731:Cyp2c40 UTSW 19 39812689 missense probably damaging 1.00
R1774:Cyp2c40 UTSW 19 39786806 missense probably damaging 1.00
R1861:Cyp2c40 UTSW 19 39786875 missense probably benign 0.11
R1977:Cyp2c40 UTSW 19 39778041 missense probably damaging 1.00
R2022:Cyp2c40 UTSW 19 39812780 unclassified probably benign
R2063:Cyp2c40 UTSW 19 39786780 missense probably benign 0.01
R2359:Cyp2c40 UTSW 19 39777954 missense probably damaging 1.00
R2413:Cyp2c40 UTSW 19 39803887 nonsense probably null
R3685:Cyp2c40 UTSW 19 39786779 missense possibly damaging 0.95
R4080:Cyp2c40 UTSW 19 39802529 missense probably benign 0.01
R4614:Cyp2c40 UTSW 19 39803856 missense probably damaging 1.00
R4661:Cyp2c40 UTSW 19 39786846 missense probably benign 0.00
R4716:Cyp2c40 UTSW 19 39802661 splice site probably null
R4799:Cyp2c40 UTSW 19 39773849 missense probably damaging 1.00
R5133:Cyp2c40 UTSW 19 39807219 missense probably benign 0.02
R5191:Cyp2c40 UTSW 19 39802591 missense probably damaging 0.96
R5310:Cyp2c40 UTSW 19 39778030 missense probably damaging 1.00
R5455:Cyp2c40 UTSW 19 39803792 missense possibly damaging 0.75
R5619:Cyp2c40 UTSW 19 39803784 missense probably damaging 1.00
R5989:Cyp2c40 UTSW 19 39807580 missense probably benign 0.45
R6175:Cyp2c40 UTSW 19 39812560 missense probably benign 0.00
R6622:Cyp2c40 UTSW 19 39802546 missense probably damaging 1.00
R6987:Cyp2c40 UTSW 19 39812767 unclassified probably benign
R7057:Cyp2c40 UTSW 19 39807619 missense probably damaging 1.00
R7485:Cyp2c40 UTSW 19 39807606 nonsense probably null
R7560:Cyp2c40 UTSW 19 39807214 missense possibly damaging 0.81
R7648:Cyp2c40 UTSW 19 39803845 makesense probably null
R7718:Cyp2c40 UTSW 19 39767338 missense probably benign 0.00
R7763:Cyp2c40 UTSW 19 39807168 missense possibly damaging 0.90
R7893:Cyp2c40 UTSW 19 39786848 missense probably damaging 0.99
R7976:Cyp2c40 UTSW 19 39786848 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- gctcagaggaccaacaacaCAAAATAATAGAA -3'
(R):5'- TCAGCCTTACTTGTCACAACTCAACAAA -3'

Sequencing Primer
(F):5'- GGGTCTTCAATCTGAAACTTAGAGC -3'
(R):5'- GTTGATTGCACAAAGATGCCC -3'
Posted On2013-11-18