Mutagenetix > Incidental Mutation

Incidental Mutation 'R1069:Gtf3c3'

86113

Institutional Source

Beutler Lab

Gene Symbol

Gtf3c3

Ensembl Gene

ENSMUSG00000041303

Gene Name

general transcription factor IIIC, polypeptide 3

Synonyms

MMRRC Submission

039155-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R1069 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54396004-54438971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 54417778 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 488 (A488T)

Ref Sequence

ENSEMBL: ENSMUSP00000039420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041638]

AlphaFold

Q3TMP1

Predicted Effect

probably damaging
Transcript: ENSMUST00000041638
AA Change: A488T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: A488T

Domain	Start	End	E-Value	Type
low complexity region	18	34	N/A	INTRINSIC
low complexity region	92	108	N/A	INTRINSIC
TPR	145	178	9.24e1	SMART
TPR	179	212	2.36e1	SMART
TPR	213	246	4.58e-4	SMART
TPR	247	280	6.4e1	SMART
Blast:TPR	286	319	6e-9	BLAST
low complexity region	353	365	N/A	INTRINSIC
TPR	452	485	1.87e1	SMART
low complexity region	549	560	N/A	INTRINSIC
TPR	807	840	3.27e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190419

Meta Mutation Damage Score

0.6542

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	G	A	9: 41,590,298	R151H	possibly damaging	Het
4921524L21Rik	A	G	18: 6,624,037	N106S	probably benign	Het
Akr1c21	C	A	13: 4,575,334		probably benign	Het
Alpk2	G	A	18: 65,305,014	R1570C	probably benign	Het
Atp8b3	G	A	10: 80,531,018	R249C	probably damaging	Het
Cacnb4	C	A	2: 52,455,611	R252I	probably damaging	Het
Cars	T	C	7: 143,570,107	T480A	probably benign	Het
Ccnf	A	T	17: 24,223,997	C745*	probably null	Het
Ccr8	A	G	9: 120,094,217	I133V	probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Dgkq	T	C	5: 108,656,037		probably benign	Het
Ecd	A	G	14: 20,333,436	C312R	probably damaging	Het
Epp13	A	T	7: 6,255,922		probably null	Het
Gstm1	T	C	3: 108,012,748	S226G	probably damaging	Het
Hacd4	T	A	4: 88,437,502	I49L	probably damaging	Het
Hid1	T	C	11: 115,356,765	N269S	probably damaging	Het
Ifitm3	A	T	7: 141,009,900		probably benign	Het
Kctd9	C	T	14: 67,729,420		probably benign	Het
Kif20b	T	C	19: 34,950,851	L1131P	probably damaging	Het
Kif2c	T	C	4: 117,178,153	T33A	probably damaging	Het
Lipc	T	C	9: 70,823,537	T38A	probably benign	Het
Lrguk	A	C	6: 34,048,883	I205L	possibly damaging	Het
Ncapg	T	A	5: 45,675,930		probably benign	Het
Ptprd	A	G	4: 75,998,487		probably benign	Het
Ptprd	T	A	4: 76,100,633	K635*	probably null	Het
Sap130	G	A	18: 31,711,629	V898I	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Tas2r131	C	T	6: 132,957,825	R7K	probably benign	Het
Tfpi	A	G	2: 84,453,792		probably benign	Het
Trim80	T	C	11: 115,448,083	C580R	probably damaging	Het
Ttn	T	A	2: 76,969,929	I312F	unknown	Het

Other mutations in Gtf3c3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Gtf3c3	APN	1	54415955	missense	probably damaging	0.99
IGL00435:Gtf3c3	APN	1	54427535	missense	possibly damaging	0.73
IGL01128:Gtf3c3	APN	1	54428876	missense	possibly damaging	0.91
R0243:Gtf3c3	UTSW	1	54403536	missense	possibly damaging	0.60
R0271:Gtf3c3	UTSW	1	54428812	missense	possibly damaging	0.96
R0571:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R0965:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R0968:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1070:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1111:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1112:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1113:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1114:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1115:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1117:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1118:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1119:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1228:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1230:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1231:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1313:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1313:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1382:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1394:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1395:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1397:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1414:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1430:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1432:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1473:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1497:Gtf3c3	UTSW	1	54437939	missense	probably benign
R1556:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1563:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1638:Gtf3c3	UTSW	1	54405119	missense	probably damaging	1.00
R1695:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1716:Gtf3c3	UTSW	1	54399260	missense	probably damaging	1.00
R1745:Gtf3c3	UTSW	1	54434212	missense	probably damaging	1.00
R1767:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1799:Gtf3c3	UTSW	1	54420424	missense	possibly damaging	0.82
R1861:Gtf3c3	UTSW	1	54438838	missense	possibly damaging	0.87
R1940:Gtf3c3	UTSW	1	54428958	splice site	probably benign
R3804:Gtf3c3	UTSW	1	54424007	critical splice donor site	probably null
R4496:Gtf3c3	UTSW	1	54424132	missense	probably benign	0.03
R4621:Gtf3c3	UTSW	1	54419416	missense	probably damaging	1.00
R5131:Gtf3c3	UTSW	1	54419498	splice site	probably null
R5320:Gtf3c3	UTSW	1	54405873	missense	probably damaging	1.00
R5605:Gtf3c3	UTSW	1	54415926	missense	probably benign	0.06
R5854:Gtf3c3	UTSW	1	54419437	missense	probably benign	0.01
R6050:Gtf3c3	UTSW	1	54406070	missense	probably benign	0.00
R6441:Gtf3c3	UTSW	1	54406038	missense	probably benign	0.03
R6892:Gtf3c3	UTSW	1	54415941	missense	probably benign	0.00
R7114:Gtf3c3	UTSW	1	54423507	missense	probably benign
R7299:Gtf3c3	UTSW	1	54417708	missense	probably benign	0.01
R7441:Gtf3c3	UTSW	1	54420448	missense	probably benign	0.00
R7586:Gtf3c3	UTSW	1	54403593	missense	probably damaging	1.00
R7615:Gtf3c3	UTSW	1	54423572	missense	possibly damaging	0.49
R7634:Gtf3c3	UTSW	1	54419641	splice site	probably null
R7739:Gtf3c3	UTSW	1	54405039	missense	possibly damaging	0.94
R8349:Gtf3c3	UTSW	1	54428909	missense	probably damaging	1.00
R8449:Gtf3c3	UTSW	1	54428909	missense	probably damaging	1.00
R8755:Gtf3c3	UTSW	1	54428872	missense	probably benign
R8955:Gtf3c3	UTSW	1	54423563	missense	probably benign	0.00
R9290:Gtf3c3	UTSW	1	54438838	missense	possibly damaging	0.87
R9353:Gtf3c3	UTSW	1	54406052	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GCCATGCAAGCCTAAAGACCTGAG -3'
(R):5'- AGGATTGCAAATCAGTGAGGCTGTG -3'

Sequencing Primer
(F):5'- gaaggaccctgatgctcac -3'
(R):5'- TCAGTGAGGCTGTGTCATAAAG -3'

Posted On

2013-11-18