Mutagenetix > Incidental Mutation

Incidental Mutation 'R1069:Cacnb4'

86115

Institutional Source

Beutler Lab

Gene Symbol

Cacnb4

Ensembl Gene

ENSMUSG00000017412

Gene Name

calcium channel, voltage-dependent, beta 4 subunit

Synonyms

Cchb4, 3110038O15Rik

MMRRC Submission

039155-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R1069 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52428320-52676831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52455611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Isoleucine at position 252 (R252I)

Ref Sequence

ENSEMBL: ENSMUSP00000099821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078324] [ENSMUST00000102760] [ENSMUST00000102761] [ENSMUST00000178799]

AlphaFold

Q8R0S4

Predicted Effect

probably damaging
Transcript: ENSMUST00000078324
AA Change: R285I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077438
Gene: ENSMUSG00000017412
AA Change: R285I

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	49	90	5.4e-27	PFAM
SH3	94	159	4.96e-2	SMART
low complexity region	172	189	N/A	INTRINSIC
low complexity region	193	206	N/A	INTRINSIC
GuKc	217	398	3.46e-37	SMART
low complexity region	465	481	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102760
AA Change: R252I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099821
Gene: ENSMUSG00000017412
AA Change: R252I

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	16	57	9.4e-28	PFAM
SH3	61	126	4.96e-2	SMART
low complexity region	139	156	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
GuKc	184	365	3.46e-37	SMART
low complexity region	432	448	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102761
AA Change: R239I

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099822
Gene: ENSMUSG00000017412
AA Change: R239I

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	3	44	4.8e-27	PFAM
SH3	48	113	4.96e-2	SMART
low complexity region	126	143	N/A	INTRINSIC
low complexity region	147	160	N/A	INTRINSIC
GuKc	171	352	3.46e-37	SMART
low complexity region	419	435	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178799
AA Change: R285I

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136811
Gene: ENSMUSG00000017412
AA Change: R285I

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	49	90	1.3e-24	PFAM
SH3	94	159	4.96e-2	SMART
low complexity region	172	189	N/A	INTRINSIC
GuKc	217	398	3.46e-37	SMART
low complexity region	465	481	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants have lethargic behavior, unstable gait and seizures, with peripheral motor nerves showing reduced conduction velocity and prolonged distal latency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	G	A	9: 41,590,298	R151H	possibly damaging	Het
4921524L21Rik	A	G	18: 6,624,037	N106S	probably benign	Het
Akr1c21	C	A	13: 4,575,334		probably benign	Het
Alpk2	G	A	18: 65,305,014	R1570C	probably benign	Het
Atp8b3	G	A	10: 80,531,018	R249C	probably damaging	Het
Cars	T	C	7: 143,570,107	T480A	probably benign	Het
Ccnf	A	T	17: 24,223,997	C745*	probably null	Het
Ccr8	A	G	9: 120,094,217	I133V	probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Dgkq	T	C	5: 108,656,037		probably benign	Het
Ecd	A	G	14: 20,333,436	C312R	probably damaging	Het
Epp13	A	T	7: 6,255,922		probably null	Het
Gstm1	T	C	3: 108,012,748	S226G	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hacd4	T	A	4: 88,437,502	I49L	probably damaging	Het
Hid1	T	C	11: 115,356,765	N269S	probably damaging	Het
Ifitm3	A	T	7: 141,009,900		probably benign	Het
Kctd9	C	T	14: 67,729,420		probably benign	Het
Kif20b	T	C	19: 34,950,851	L1131P	probably damaging	Het
Kif2c	T	C	4: 117,178,153	T33A	probably damaging	Het
Lipc	T	C	9: 70,823,537	T38A	probably benign	Het
Lrguk	A	C	6: 34,048,883	I205L	possibly damaging	Het
Ncapg	T	A	5: 45,675,930		probably benign	Het
Ptprd	A	G	4: 75,998,487		probably benign	Het
Ptprd	T	A	4: 76,100,633	K635*	probably null	Het
Sap130	G	A	18: 31,711,629	V898I	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Tas2r131	C	T	6: 132,957,825	R7K	probably benign	Het
Tfpi	A	G	2: 84,453,792		probably benign	Het
Trim80	T	C	11: 115,448,083	C580R	probably damaging	Het
Ttn	T	A	2: 76,969,929	I312F	unknown	Het

Other mutations in Cacnb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Cacnb4	APN	2	52477712	missense	possibly damaging	0.46
IGL01328:Cacnb4	APN	2	52464625	missense	probably damaging	1.00
IGL01801:Cacnb4	APN	2	52434711	missense	probably benign	0.15
IGL01992:Cacnb4	APN	2	52465670	missense	probably damaging	1.00
IGL03030:Cacnb4	APN	2	52474882	missense	probably damaging	1.00
R0789:Cacnb4	UTSW	2	52451883	missense	probably damaging	1.00
R1646:Cacnb4	UTSW	2	52474900	missense	possibly damaging	0.87
R2050:Cacnb4	UTSW	2	52469586	missense	probably damaging	0.99
R3939:Cacnb4	UTSW	2	52469489	missense	probably damaging	1.00
R3941:Cacnb4	UTSW	2	52469489	missense	probably damaging	1.00
R4455:Cacnb4	UTSW	2	52465653	missense	probably damaging	1.00
R4497:Cacnb4	UTSW	2	52477771	missense	probably damaging	1.00
R4707:Cacnb4	UTSW	2	52474915	missense	probably benign	0.45
R4824:Cacnb4	UTSW	2	52675810	missense	probably benign	0.00
R4957:Cacnb4	UTSW	2	52558291	missense	probably damaging	0.99
R5913:Cacnb4	UTSW	2	52434784	intron	probably benign
R6372:Cacnb4	UTSW	2	52434667	missense	probably benign	0.00
R6945:Cacnb4	UTSW	2	52474954	missense	probably damaging	1.00
R7557:Cacnb4	UTSW	2	52469567	missense	probably damaging	1.00
R7821:Cacnb4	UTSW	2	52434508	missense	possibly damaging	0.91
R8015:Cacnb4	UTSW	2	52464643	missense	probably damaging	1.00
R8043:Cacnb4	UTSW	2	52465651	missense	probably damaging	1.00
R8181:Cacnb4	UTSW	2	52474985	missense	probably benign	0.00
R8376:Cacnb4	UTSW	2	52464653	nonsense	probably null
R8466:Cacnb4	UTSW	2	52464667	missense	probably damaging	1.00
R8765:Cacnb4	UTSW	2	52436989	missense	probably damaging	0.99
R9018:Cacnb4	UTSW	2	52434694	missense	probably benign	0.26
R9574:Cacnb4	UTSW	2	52437004	missense	probably damaging	1.00
R9624:Cacnb4	UTSW	2	52474930	missense	probably benign	0.09
R9778:Cacnb4	UTSW	2	52469603	missense	probably damaging	0.96
Z1176:Cacnb4	UTSW	2	52675812	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATTCTGGCTGCTGCAAGGACTC -3'
(R):5'- CAAAGCCTGCCGCCATTCATTG -3'

Sequencing Primer
(F):5'- AAGGACTCTGCCCCTGTC -3'
(R):5'- GTGAAGTATCTGCTAAGCACTGC -3'

Posted On

2013-11-18