Incidental Mutation 'R1069:Tfpi'
ID86117
Institutional Source Beutler Lab
Gene Symbol Tfpi
Ensembl Gene ENSMUSG00000027082
Gene Nametissue factor pathway inhibitor
Synonyms
MMRRC Submission 039155-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1069 (G1)
Quality Score211
Status Validated
Chromosome2
Chromosomal Location84432855-84476775 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 84453792 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028487] [ENSMUST00000090732] [ENSMUST00000111711] [ENSMUST00000111714] [ENSMUST00000111717] [ENSMUST00000111718] [ENSMUST00000111722] [ENSMUST00000150261]
Predicted Effect probably benign
Transcript: ENSMUST00000028487
SMART Domains Protein: ENSMUSP00000028487
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090732
SMART Domains Protein: ENSMUSP00000088235
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111711
SMART Domains Protein: ENSMUSP00000107340
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111714
SMART Domains Protein: ENSMUSP00000107343
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111717
SMART Domains Protein: ENSMUSP00000107346
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111718
SMART Domains Protein: ENSMUSP00000107347
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111722
SMART Domains Protein: ENSMUSP00000107351
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 217 270 2.25e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144775
Predicted Effect probably benign
Transcript: ENSMUST00000150261
SMART Domains Protein: ENSMUSP00000122776
Gene: ENSMUSG00000027082

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KU 41 94 4.4e-25 SMART
KU 112 165 7.97e-23 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant embryos die showing hemorrhages of the yolk sac, central nervous system, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik G A 9: 41,590,298 R151H possibly damaging Het
4921524L21Rik A G 18: 6,624,037 N106S probably benign Het
Akr1c21 C A 13: 4,575,334 probably benign Het
Alpk2 G A 18: 65,305,014 R1570C probably benign Het
Atp8b3 G A 10: 80,531,018 R249C probably damaging Het
Cacnb4 C A 2: 52,455,611 R252I probably damaging Het
Cars T C 7: 143,570,107 T480A probably benign Het
Ccnf A T 17: 24,223,997 C745* probably null Het
Ccr8 A G 9: 120,094,217 I133V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dgkq T C 5: 108,656,037 probably benign Het
Ecd A G 14: 20,333,436 C312R probably damaging Het
Epp13 A T 7: 6,255,922 probably null Het
Gstm1 T C 3: 108,012,748 S226G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hacd4 T A 4: 88,437,502 I49L probably damaging Het
Hid1 T C 11: 115,356,765 N269S probably damaging Het
Ifitm3 A T 7: 141,009,900 probably benign Het
Kctd9 C T 14: 67,729,420 probably benign Het
Kif20b T C 19: 34,950,851 L1131P probably damaging Het
Kif2c T C 4: 117,178,153 T33A probably damaging Het
Lipc T C 9: 70,823,537 T38A probably benign Het
Lrguk A C 6: 34,048,883 I205L possibly damaging Het
Ncapg T A 5: 45,675,930 probably benign Het
Ptprd A G 4: 75,998,487 probably benign Het
Ptprd T A 4: 76,100,633 K635* probably null Het
Sap130 G A 18: 31,711,629 V898I probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Tas2r131 C T 6: 132,957,825 R7K probably benign Het
Trim80 T C 11: 115,448,083 C580R probably damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Other mutations in Tfpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tfpi APN 2 84444825 nonsense probably null
IGL01860:Tfpi APN 2 84444034 missense probably benign 0.00
IGL02434:Tfpi APN 2 84452548 splice site probably benign
IGL03087:Tfpi APN 2 84444045 missense possibly damaging 0.61
I1329:Tfpi UTSW 2 84444116 missense possibly damaging 0.77
R0883:Tfpi UTSW 2 84443320 splice site probably benign
R1577:Tfpi UTSW 2 84433103 missense probably damaging 0.97
R1854:Tfpi UTSW 2 84458107 missense probably benign 0.00
R1991:Tfpi UTSW 2 84458016 splice site probably benign
R2910:Tfpi UTSW 2 84444093 missense possibly damaging 0.93
R3085:Tfpi UTSW 2 84442883 utr 3 prime probably benign
R4403:Tfpi UTSW 2 84444862 missense probably damaging 0.98
R4473:Tfpi UTSW 2 84458082 missense probably null 1.00
R4878:Tfpi UTSW 2 84452555 critical splice donor site probably null
R5810:Tfpi UTSW 2 84434424 intron probably benign
R5949:Tfpi UTSW 2 84444748 missense probably benign 0.37
R6899:Tfpi UTSW 2 84444809 missense probably damaging 1.00
R8024:Tfpi UTSW 2 84453922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACAACTGTTTCCTGACTGCCCAG -3'
(R):5'- TGGGGTCAATGAAACCGCTACATAC -3'

Sequencing Primer
(F):5'- GTCATTGTACCTATGAAAGTCTTCC -3'
(R):5'- GAAACCGCTACATACATTTTGTGC -3'
Posted On2013-11-18