Mutagenetix > Incidental Mutation

Incidental Mutation 'R1069:Tfpi'

86117

Institutional Source

Beutler Lab

Gene Symbol

Tfpi

Ensembl Gene

ENSMUSG00000027082

Gene Name

tissue factor pathway inhibitor

Synonyms

MMRRC Submission

039155-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1069 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

84432855-84476775 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 84453792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028487] [ENSMUST00000090732] [ENSMUST00000111711] [ENSMUST00000111714] [ENSMUST00000111717] [ENSMUST00000111718] [ENSMUST00000111722] [ENSMUST00000150261]

AlphaFold

O54819

Predicted Effect

probably benign
Transcript: ENSMUST00000028487

SMART Domains

Protein: ENSMUSP00000028487
Gene: ENSMUSG00000027082

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
KU	48	101	4.4e-25	SMART
KU	119	172	7.97e-23	SMART
KU	223	276	2.25e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090732

SMART Domains

Protein: ENSMUSP00000088235
Gene: ENSMUSG00000027082

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
KU	48	101	4.4e-25	SMART
KU	119	172	7.97e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111711

SMART Domains

Protein: ENSMUSP00000107340
Gene: ENSMUSG00000027082

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
KU	48	101	4.4e-25	SMART
KU	119	172	7.97e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111714

SMART Domains

Protein: ENSMUSP00000107343
Gene: ENSMUSG00000027082

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
KU	48	101	4.4e-25	SMART
KU	119	172	7.97e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111717

SMART Domains

Protein: ENSMUSP00000107346
Gene: ENSMUSG00000027082

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
KU	48	101	4.4e-25	SMART
KU	119	172	7.97e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111718

SMART Domains

Protein: ENSMUSP00000107347
Gene: ENSMUSG00000027082

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
KU	48	101	4.4e-25	SMART
KU	119	172	7.97e-23	SMART
KU	223	276	2.25e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111722

SMART Domains

Protein: ENSMUSP00000107351
Gene: ENSMUSG00000027082

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
KU	48	101	4.4e-25	SMART
KU	119	172	7.97e-23	SMART
KU	217	270	2.25e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144775

Predicted Effect

probably benign
Transcript: ENSMUST00000150261

SMART Domains

Protein: ENSMUSP00000122776
Gene: ENSMUSG00000027082

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
KU	41	94	4.4e-25	SMART
KU	112	165	7.97e-23	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant embryos die showing hemorrhages of the yolk sac, central nervous system, and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	G	A	9: 41,590,298	R151H	possibly damaging	Het
4921524L21Rik	A	G	18: 6,624,037	N106S	probably benign	Het
Akr1c21	C	A	13: 4,575,334		probably benign	Het
Alpk2	G	A	18: 65,305,014	R1570C	probably benign	Het
Atp8b3	G	A	10: 80,531,018	R249C	probably damaging	Het
Cacnb4	C	A	2: 52,455,611	R252I	probably damaging	Het
Cars	T	C	7: 143,570,107	T480A	probably benign	Het
Ccnf	A	T	17: 24,223,997	C745*	probably null	Het
Ccr8	A	G	9: 120,094,217	I133V	probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Dgkq	T	C	5: 108,656,037		probably benign	Het
Ecd	A	G	14: 20,333,436	C312R	probably damaging	Het
Epp13	A	T	7: 6,255,922		probably null	Het
Gstm1	T	C	3: 108,012,748	S226G	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hacd4	T	A	4: 88,437,502	I49L	probably damaging	Het
Hid1	T	C	11: 115,356,765	N269S	probably damaging	Het
Ifitm3	A	T	7: 141,009,900		probably benign	Het
Kctd9	C	T	14: 67,729,420		probably benign	Het
Kif20b	T	C	19: 34,950,851	L1131P	probably damaging	Het
Kif2c	T	C	4: 117,178,153	T33A	probably damaging	Het
Lipc	T	C	9: 70,823,537	T38A	probably benign	Het
Lrguk	A	C	6: 34,048,883	I205L	possibly damaging	Het
Ncapg	T	A	5: 45,675,930		probably benign	Het
Ptprd	A	G	4: 75,998,487		probably benign	Het
Ptprd	T	A	4: 76,100,633	K635*	probably null	Het
Sap130	G	A	18: 31,711,629	V898I	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Tas2r131	C	T	6: 132,957,825	R7K	probably benign	Het
Trim80	T	C	11: 115,448,083	C580R	probably damaging	Het
Ttn	T	A	2: 76,969,929	I312F	unknown	Het

Other mutations in Tfpi

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01484:Tfpi	APN	2	84444825	nonsense	probably null
IGL01860:Tfpi	APN	2	84444034	missense	probably benign	0.00
IGL02434:Tfpi	APN	2	84452548	splice site	probably benign
IGL03087:Tfpi	APN	2	84444045	missense	possibly damaging	0.61
I1329:Tfpi	UTSW	2	84444116	missense	possibly damaging	0.77
R0883:Tfpi	UTSW	2	84443320	splice site	probably benign
R1577:Tfpi	UTSW	2	84433103	missense	probably damaging	0.97
R1854:Tfpi	UTSW	2	84458107	missense	probably benign	0.00
R1991:Tfpi	UTSW	2	84458016	splice site	probably benign
R2910:Tfpi	UTSW	2	84444093	missense	possibly damaging	0.93
R3085:Tfpi	UTSW	2	84442883	utr 3 prime	probably benign
R4403:Tfpi	UTSW	2	84444862	missense	probably damaging	0.98
R4473:Tfpi	UTSW	2	84458082	missense	probably null	1.00
R4878:Tfpi	UTSW	2	84452555	critical splice donor site	probably null
R5810:Tfpi	UTSW	2	84434424	intron	probably benign
R5949:Tfpi	UTSW	2	84444748	missense	probably benign	0.37
R6899:Tfpi	UTSW	2	84444809	missense	probably damaging	1.00
R8024:Tfpi	UTSW	2	84453922	missense	possibly damaging	0.86
R9068:Tfpi	UTSW	2	84442891	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACAACTGTTTCCTGACTGCCCAG -3'
(R):5'- TGGGGTCAATGAAACCGCTACATAC -3'

Sequencing Primer
(F):5'- GTCATTGTACCTATGAAAGTCTTCC -3'
(R):5'- GAAACCGCTACATACATTTTGTGC -3'

Posted On

2013-11-18