Incidental Mutation 'R1069:Gstm1'
ID 86118
Institutional Source Beutler Lab
Gene Symbol Gstm1
Ensembl Gene ENSMUSG00000058135
Gene Name glutathione S-transferase, mu 1
Synonyms Gstb-1, Gstb1
MMRRC Submission 039155-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R1069 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 108012255-108017973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108012748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 226 (S226G)
Ref Sequence ENSEMBL: ENSMUSP00000118874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000153314]
AlphaFold P10649
Predicted Effect probably damaging
Transcript: ENSMUST00000004140
AA Change: S200G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135
AA Change: S200G

DomainStartEndE-ValueType
Pfam:GST_N 3 82 1.3e-20 PFAM
Pfam:GST_C_3 40 190 5.2e-11 PFAM
Pfam:GST_C 104 192 3.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126593
AA Change: S226G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135
AA Change: S226G

DomainStartEndE-ValueType
Pfam:GST_N 3 82 8.3e-24 PFAM
Pfam:GST_C 104 201 6.7e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153314
AA Change: S176G

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135
AA Change: S176G

DomainStartEndE-ValueType
Pfam:GST_N 1 23 1.7e-7 PFAM
Pfam:GST_C 45 168 1.2e-18 PFAM
Pfam:GST_C_3 92 166 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198532
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik G A 9: 41,590,298 R151H possibly damaging Het
4921524L21Rik A G 18: 6,624,037 N106S probably benign Het
Akr1c21 C A 13: 4,575,334 probably benign Het
Alpk2 G A 18: 65,305,014 R1570C probably benign Het
Atp8b3 G A 10: 80,531,018 R249C probably damaging Het
Cacnb4 C A 2: 52,455,611 R252I probably damaging Het
Cars T C 7: 143,570,107 T480A probably benign Het
Ccnf A T 17: 24,223,997 C745* probably null Het
Ccr8 A G 9: 120,094,217 I133V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dgkq T C 5: 108,656,037 probably benign Het
Ecd A G 14: 20,333,436 C312R probably damaging Het
Epp13 A T 7: 6,255,922 probably null Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hacd4 T A 4: 88,437,502 I49L probably damaging Het
Hid1 T C 11: 115,356,765 N269S probably damaging Het
Ifitm3 A T 7: 141,009,900 probably benign Het
Kctd9 C T 14: 67,729,420 probably benign Het
Kif20b T C 19: 34,950,851 L1131P probably damaging Het
Kif2c T C 4: 117,178,153 T33A probably damaging Het
Lipc T C 9: 70,823,537 T38A probably benign Het
Lrguk A C 6: 34,048,883 I205L possibly damaging Het
Ncapg T A 5: 45,675,930 probably benign Het
Ptprd A G 4: 75,998,487 probably benign Het
Ptprd T A 4: 76,100,633 K635* probably null Het
Sap130 G A 18: 31,711,629 V898I probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Tas2r131 C T 6: 132,957,825 R7K probably benign Het
Tfpi A G 2: 84,453,792 probably benign Het
Trim80 T C 11: 115,448,083 C580R probably damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Other mutations in Gstm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0335:Gstm1 UTSW 3 108012696 missense possibly damaging 0.87
R0458:Gstm1 UTSW 3 108017363 missense probably benign 0.01
R0907:Gstm1 UTSW 3 108017380 missense probably damaging 1.00
R1180:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R1181:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R1998:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R2000:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R4483:Gstm1 UTSW 3 108016518 critical splice donor site probably null
R4857:Gstm1 UTSW 3 108016408 missense possibly damaging 0.67
R5192:Gstm1 UTSW 3 108014943 critical splice donor site probably null
R5262:Gstm1 UTSW 3 108016363 missense probably benign 0.01
R5356:Gstm1 UTSW 3 108012736 missense probably benign 0.00
R5485:Gstm1 UTSW 3 108017404 missense probably damaging 1.00
R6323:Gstm1 UTSW 3 108017747 missense probably benign 0.44
R7165:Gstm1 UTSW 3 108016377 missense probably benign
R7250:Gstm1 UTSW 3 108016393 missense probably damaging 0.98
R7638:Gstm1 UTSW 3 108014550 splice site probably null
R9656:Gstm1 UTSW 3 108017756 missense probably damaging 1.00
R9797:Gstm1 UTSW 3 108017764 missense probably benign 0.10
X0023:Gstm1 UTSW 3 108012727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGAAGGCTGTGTGGACTTGAC -3'
(R):5'- TCCCCTTGAATATGGGGAATGGGAG -3'

Sequencing Primer
(F):5'- ATGGGGCTGACCAAGCTG -3'
(R):5'- TCCAGCATGAGTTCAGGACA -3'
Posted On 2013-11-18