Mutagenetix > Incidental Mutation

Incidental Mutation 'R1069:Gstm1'

86118

Institutional Source

Beutler Lab

Gene Symbol

Gstm1

Ensembl Gene

ENSMUSG00000058135

Gene Name

glutathione S-transferase, mu 1

Synonyms

Gstb1, Gstb-1

MMRRC Submission

039155-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R1069 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107919571-107925289 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107920064 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 226 (S226G)

Ref Sequence

ENSEMBL: ENSMUSP00000118874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000153314]

AlphaFold

P10649

Predicted Effect

probably damaging
Transcript: ENSMUST00000004140
AA Change: S200G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135
AA Change: S200G

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	1.3e-20	PFAM
Pfam:GST_C_3	40	190	5.2e-11	PFAM
Pfam:GST_C	104	192	3.7e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000126593
AA Change: S226G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135
AA Change: S226G

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	8.3e-24	PFAM
Pfam:GST_C	104	201	6.7e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153314
AA Change: S176G

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135
AA Change: S176G

Domain	Start	End	E-Value	Type
Pfam:GST_N	1	23	1.7e-7	PFAM
Pfam:GST_C	45	168	1.2e-18	PFAM
Pfam:GST_C_3	92	166	8.3e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198532

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	A	G	18: 6,624,037 (GRCm39)	N106S	probably benign	Het
Akr1c21	C	A	13: 4,625,333 (GRCm39)		probably benign	Het
Alpk2	G	A	18: 65,438,085 (GRCm39)	R1570C	probably benign	Het
Atp8b3	G	A	10: 80,366,852 (GRCm39)	R249C	probably damaging	Het
Cacnb4	C	A	2: 52,345,623 (GRCm39)	R252I	probably damaging	Het
Cars1	T	C	7: 143,123,844 (GRCm39)	T480A	probably benign	Het
Ccnf	A	T	17: 24,442,971 (GRCm39)	C745*	probably null	Het
Ccr8	A	G	9: 119,923,283 (GRCm39)	I133V	probably benign	Het
Cndp1	G	A	18: 84,652,777 (GRCm39)		probably benign	Het
Dgkq	T	C	5: 108,803,903 (GRCm39)		probably benign	Het
Ecd	A	G	14: 20,383,504 (GRCm39)	C312R	probably damaging	Het
Eddm13	A	T	7: 6,258,921 (GRCm39)		probably null	Het
Gtf3c3	C	T	1: 54,456,937 (GRCm39)	A488T	probably damaging	Het
Hacd4	T	A	4: 88,355,739 (GRCm39)	I49L	probably damaging	Het
Hid1	T	C	11: 115,247,591 (GRCm39)	N269S	probably damaging	Het
Ifitm3	A	T	7: 140,589,813 (GRCm39)		probably benign	Het
Kctd9	C	T	14: 67,966,869 (GRCm39)		probably benign	Het
Kif20b	T	C	19: 34,928,251 (GRCm39)	L1131P	probably damaging	Het
Kif2c	T	C	4: 117,035,350 (GRCm39)	T33A	probably damaging	Het
Lipc	T	C	9: 70,730,819 (GRCm39)	T38A	probably benign	Het
Lrguk	A	C	6: 34,025,818 (GRCm39)	I205L	possibly damaging	Het
Mir100hg	G	A	9: 41,501,594 (GRCm39)	R151H	possibly damaging	Het
Ncapg	T	A	5: 45,833,272 (GRCm39)		probably benign	Het
Ptprd	A	G	4: 75,916,724 (GRCm39)		probably benign	Het
Ptprd	T	A	4: 76,018,870 (GRCm39)	K635*	probably null	Het
Sap130	G	A	18: 31,844,682 (GRCm39)	V898I	probably damaging	Het
Sned1	G	A	1: 93,209,376 (GRCm39)	V830M	possibly damaging	Het
Svep1	C	T	4: 58,070,239 (GRCm39)	G2516R	probably damaging	Het
Tas2r131	C	T	6: 132,934,788 (GRCm39)	R7K	probably benign	Het
Tfpi	A	G	2: 84,284,136 (GRCm39)		probably benign	Het
Trim80	T	C	11: 115,338,909 (GRCm39)	C580R	probably damaging	Het
Ttn	T	A	2: 76,800,273 (GRCm39)	I312F	unknown	Het

Other mutations in Gstm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0335:Gstm1	UTSW	3	107,920,012 (GRCm39)	missense	possibly damaging	0.87
R0458:Gstm1	UTSW	3	107,924,679 (GRCm39)	missense	probably benign	0.01
R0907:Gstm1	UTSW	3	107,924,696 (GRCm39)	missense	probably damaging	1.00
R1180:Gstm1	UTSW	3	107,922,127 (GRCm39)	missense	probably damaging	1.00
R1181:Gstm1	UTSW	3	107,922,127 (GRCm39)	missense	probably damaging	1.00
R1998:Gstm1	UTSW	3	107,922,127 (GRCm39)	missense	probably damaging	1.00
R2000:Gstm1	UTSW	3	107,922,127 (GRCm39)	missense	probably damaging	1.00
R4483:Gstm1	UTSW	3	107,923,834 (GRCm39)	critical splice donor site	probably null
R4857:Gstm1	UTSW	3	107,923,724 (GRCm39)	missense	possibly damaging	0.67
R5192:Gstm1	UTSW	3	107,922,259 (GRCm39)	critical splice donor site	probably null
R5262:Gstm1	UTSW	3	107,923,679 (GRCm39)	missense	probably benign	0.01
R5356:Gstm1	UTSW	3	107,920,052 (GRCm39)	missense	probably benign	0.00
R5485:Gstm1	UTSW	3	107,924,720 (GRCm39)	missense	probably damaging	1.00
R6323:Gstm1	UTSW	3	107,925,063 (GRCm39)	missense	probably benign	0.44
R7165:Gstm1	UTSW	3	107,923,693 (GRCm39)	missense	probably benign
R7250:Gstm1	UTSW	3	107,923,709 (GRCm39)	missense	probably damaging	0.98
R7638:Gstm1	UTSW	3	107,921,866 (GRCm39)	splice site	probably null
R9656:Gstm1	UTSW	3	107,925,072 (GRCm39)	missense	probably damaging	1.00
R9797:Gstm1	UTSW	3	107,925,080 (GRCm39)	missense	probably benign	0.10
X0023:Gstm1	UTSW	3	107,920,043 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAATGAAGGCTGTGTGGACTTGAC -3'
(R):5'- TCCCCTTGAATATGGGGAATGGGAG -3'

Sequencing Primer
(F):5'- ATGGGGCTGACCAAGCTG -3'
(R):5'- TCCAGCATGAGTTCAGGACA -3'

Posted On

2013-11-18