Incidental Mutation 'R1069:Kif2c'
ID 86123
Institutional Source Beutler Lab
Gene Symbol Kif2c
Ensembl Gene ENSMUSG00000028678
Gene Name kinesin family member 2C
Synonyms 4930402F02Rik
MMRRC Submission 039155-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1069 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 117159639-117182639 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117178153 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 33 (T33A)
Ref Sequence ENSEMBL: ENSMUSP00000122655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065896] [ENSMUST00000106436] [ENSMUST00000153953]
AlphaFold Q922S8
Predicted Effect probably benign
Transcript: ENSMUST00000065896
AA Change: T84A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064261
Gene: ENSMUSG00000028678
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 192 205 N/A INTRINSIC
KISc 252 590 1.04e-131 SMART
coiled coil region 615 647 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106436
AA Change: T33A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102044
Gene: ENSMUSG00000028678
AA Change: T33A

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
KISc 201 539 1.04e-131 SMART
coiled coil region 564 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148918
Predicted Effect probably damaging
Transcript: ENSMUST00000153953
AA Change: T33A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin-like protein that functions as a microtubule-dependent molecular motor. The encoded protein can depolymerize microtubules at the plus end, thereby promoting mitotic chromosome segregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik G A 9: 41,590,298 R151H possibly damaging Het
4921524L21Rik A G 18: 6,624,037 N106S probably benign Het
Akr1c21 C A 13: 4,575,334 probably benign Het
Alpk2 G A 18: 65,305,014 R1570C probably benign Het
Atp8b3 G A 10: 80,531,018 R249C probably damaging Het
Cacnb4 C A 2: 52,455,611 R252I probably damaging Het
Cars T C 7: 143,570,107 T480A probably benign Het
Ccnf A T 17: 24,223,997 C745* probably null Het
Ccr8 A G 9: 120,094,217 I133V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dgkq T C 5: 108,656,037 probably benign Het
Ecd A G 14: 20,333,436 C312R probably damaging Het
Epp13 A T 7: 6,255,922 probably null Het
Gstm1 T C 3: 108,012,748 S226G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hacd4 T A 4: 88,437,502 I49L probably damaging Het
Hid1 T C 11: 115,356,765 N269S probably damaging Het
Ifitm3 A T 7: 141,009,900 probably benign Het
Kctd9 C T 14: 67,729,420 probably benign Het
Kif20b T C 19: 34,950,851 L1131P probably damaging Het
Lipc T C 9: 70,823,537 T38A probably benign Het
Lrguk A C 6: 34,048,883 I205L possibly damaging Het
Ncapg T A 5: 45,675,930 probably benign Het
Ptprd A G 4: 75,998,487 probably benign Het
Ptprd T A 4: 76,100,633 K635* probably null Het
Sap130 G A 18: 31,711,629 V898I probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Tas2r131 C T 6: 132,957,825 R7K probably benign Het
Tfpi A G 2: 84,453,792 probably benign Het
Trim80 T C 11: 115,448,083 C580R probably damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Other mutations in Kif2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Kif2c APN 4 117178246 missense probably benign 0.01
IGL01020:Kif2c APN 4 117166904 missense probably damaging 1.00
IGL01131:Kif2c APN 4 117172365 missense probably damaging 1.00
IGL02131:Kif2c APN 4 117177953 missense possibly damaging 0.88
IGL02455:Kif2c APN 4 117172354 missense probably benign
IGL02556:Kif2c APN 4 117162605 missense probably damaging 0.98
IGL03084:Kif2c APN 4 117178158 missense possibly damaging 0.67
IGL03333:Kif2c APN 4 117180636 missense possibly damaging 0.87
IGL03353:Kif2c APN 4 117166336 missense probably benign 0.19
R0025:Kif2c UTSW 4 117165517 missense probably damaging 1.00
R0466:Kif2c UTSW 4 117172292 missense possibly damaging 0.83
R1519:Kif2c UTSW 4 117169940 missense probably damaging 1.00
R1594:Kif2c UTSW 4 117178188 missense probably benign 0.02
R1789:Kif2c UTSW 4 117167361 missense probably benign 0.18
R1894:Kif2c UTSW 4 117162223 missense probably benign 0.02
R2340:Kif2c UTSW 4 117169841 missense probably damaging 1.00
R2830:Kif2c UTSW 4 117182448 splice site probably null
R3734:Kif2c UTSW 4 117162646 missense probably benign 0.02
R4634:Kif2c UTSW 4 117178240 missense probably benign 0.04
R4720:Kif2c UTSW 4 117171749 missense probably benign
R4908:Kif2c UTSW 4 117166411 missense probably damaging 1.00
R5076:Kif2c UTSW 4 117174869 unclassified probably benign
R5855:Kif2c UTSW 4 117182542 unclassified probably benign
R6766:Kif2c UTSW 4 117167083 missense probably benign
R6767:Kif2c UTSW 4 117178188 missense probably benign 0.00
R6942:Kif2c UTSW 4 117166378 missense probably damaging 1.00
R7378:Kif2c UTSW 4 117162029 missense possibly damaging 0.46
R7526:Kif2c UTSW 4 117182432 missense possibly damaging 0.46
R7797:Kif2c UTSW 4 117171743 missense probably benign 0.00
R8087:Kif2c UTSW 4 117165418 missense possibly damaging 0.92
R9123:Kif2c UTSW 4 117167094 missense probably benign 0.09
R9319:Kif2c UTSW 4 117178248 critical splice acceptor site probably null
U24488:Kif2c UTSW 4 117182442 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACTACTCTGGCTTCCACTCTGAG -3'
(R):5'- TTGGAAACTGGAACCCCATTCCATC -3'

Sequencing Primer
(F):5'- GCGTTTTTGCTTCTGAAAAACAG -3'
(R):5'- AGGTTGGTAAAGCCTCCATC -3'
Posted On 2013-11-18