Incidental Mutation 'R1069:Dgkq'
ID 86124
Institutional Source Beutler Lab
Gene Symbol Dgkq
Ensembl Gene ENSMUSG00000004815
Gene Name diacylglycerol kinase, theta
Synonyms Dagk4, Dgk theta, 110kDa, DAGK7, Dgkd
MMRRC Submission 039155-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1069 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 108794910-108808696 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 108803903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053913] [ENSMUST00000071650] [ENSMUST00000132179] [ENSMUST00000132708] [ENSMUST00000153238]
AlphaFold Q6P5E8
Predicted Effect probably benign
Transcript: ENSMUST00000053913
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071650
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123669
Predicted Effect probably benign
Transcript: ENSMUST00000132179
SMART Domains Protein: ENSMUSP00000118466
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144624
Predicted Effect probably benign
Transcript: ENSMUST00000153238
SMART Domains Protein: ENSMUSP00000118065
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156964
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,624,037 (GRCm39) N106S probably benign Het
Akr1c21 C A 13: 4,625,333 (GRCm39) probably benign Het
Alpk2 G A 18: 65,438,085 (GRCm39) R1570C probably benign Het
Atp8b3 G A 10: 80,366,852 (GRCm39) R249C probably damaging Het
Cacnb4 C A 2: 52,345,623 (GRCm39) R252I probably damaging Het
Cars1 T C 7: 143,123,844 (GRCm39) T480A probably benign Het
Ccnf A T 17: 24,442,971 (GRCm39) C745* probably null Het
Ccr8 A G 9: 119,923,283 (GRCm39) I133V probably benign Het
Cndp1 G A 18: 84,652,777 (GRCm39) probably benign Het
Ecd A G 14: 20,383,504 (GRCm39) C312R probably damaging Het
Eddm13 A T 7: 6,258,921 (GRCm39) probably null Het
Gstm1 T C 3: 107,920,064 (GRCm39) S226G probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Hacd4 T A 4: 88,355,739 (GRCm39) I49L probably damaging Het
Hid1 T C 11: 115,247,591 (GRCm39) N269S probably damaging Het
Ifitm3 A T 7: 140,589,813 (GRCm39) probably benign Het
Kctd9 C T 14: 67,966,869 (GRCm39) probably benign Het
Kif20b T C 19: 34,928,251 (GRCm39) L1131P probably damaging Het
Kif2c T C 4: 117,035,350 (GRCm39) T33A probably damaging Het
Lipc T C 9: 70,730,819 (GRCm39) T38A probably benign Het
Lrguk A C 6: 34,025,818 (GRCm39) I205L possibly damaging Het
Mir100hg G A 9: 41,501,594 (GRCm39) R151H possibly damaging Het
Ncapg T A 5: 45,833,272 (GRCm39) probably benign Het
Ptprd A G 4: 75,916,724 (GRCm39) probably benign Het
Ptprd T A 4: 76,018,870 (GRCm39) K635* probably null Het
Sap130 G A 18: 31,844,682 (GRCm39) V898I probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Svep1 C T 4: 58,070,239 (GRCm39) G2516R probably damaging Het
Tas2r131 C T 6: 132,934,788 (GRCm39) R7K probably benign Het
Tfpi A G 2: 84,284,136 (GRCm39) probably benign Het
Trim80 T C 11: 115,338,909 (GRCm39) C580R probably damaging Het
Ttn T A 2: 76,800,273 (GRCm39) I312F unknown Het
Other mutations in Dgkq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dgkq APN 5 108,802,448 (GRCm39) missense possibly damaging 0.72
IGL02364:Dgkq APN 5 108,804,310 (GRCm39) missense probably benign 0.05
IGL02966:Dgkq APN 5 108,804,287 (GRCm39) splice site probably null
IGL03297:Dgkq APN 5 108,798,140 (GRCm39) missense probably damaging 1.00
R0179:Dgkq UTSW 5 108,806,066 (GRCm39) splice site probably benign
R0194:Dgkq UTSW 5 108,802,510 (GRCm39) intron probably benign
R0332:Dgkq UTSW 5 108,802,965 (GRCm39) splice site probably benign
R0513:Dgkq UTSW 5 108,804,361 (GRCm39) missense probably benign 0.02
R0525:Dgkq UTSW 5 108,802,481 (GRCm39) missense probably damaging 1.00
R0673:Dgkq UTSW 5 108,803,455 (GRCm39) missense probably damaging 0.97
R0801:Dgkq UTSW 5 108,808,586 (GRCm39) splice site probably null
R0850:Dgkq UTSW 5 108,802,444 (GRCm39) missense possibly damaging 0.82
R0944:Dgkq UTSW 5 108,804,331 (GRCm39) missense probably damaging 1.00
R1411:Dgkq UTSW 5 108,798,228 (GRCm39) missense probably damaging 1.00
R1488:Dgkq UTSW 5 108,798,743 (GRCm39) missense probably damaging 1.00
R1858:Dgkq UTSW 5 108,801,597 (GRCm39) missense probably benign 0.00
R1874:Dgkq UTSW 5 108,808,461 (GRCm39) missense probably benign 0.07
R2210:Dgkq UTSW 5 108,808,389 (GRCm39) missense probably damaging 1.00
R4499:Dgkq UTSW 5 108,797,527 (GRCm39) missense possibly damaging 0.54
R5061:Dgkq UTSW 5 108,801,989 (GRCm39) missense probably benign 0.02
R5474:Dgkq UTSW 5 108,797,009 (GRCm39) critical splice donor site probably null
R5481:Dgkq UTSW 5 108,796,676 (GRCm39) splice site probably null
R5951:Dgkq UTSW 5 108,802,236 (GRCm39) missense probably damaging 1.00
R6193:Dgkq UTSW 5 108,803,366 (GRCm39) nonsense probably null
R6429:Dgkq UTSW 5 108,801,574 (GRCm39) missense probably damaging 1.00
R6458:Dgkq UTSW 5 108,802,242 (GRCm39) missense possibly damaging 0.93
R7388:Dgkq UTSW 5 108,806,112 (GRCm39) missense probably damaging 0.99
R7398:Dgkq UTSW 5 108,803,056 (GRCm39) missense possibly damaging 0.90
R8098:Dgkq UTSW 5 108,800,334 (GRCm39) missense probably damaging 1.00
R8244:Dgkq UTSW 5 108,796,578 (GRCm39) makesense probably null
R8956:Dgkq UTSW 5 108,798,095 (GRCm39) missense probably benign 0.22
R9043:Dgkq UTSW 5 108,801,061 (GRCm39) missense probably damaging 1.00
R9360:Dgkq UTSW 5 108,798,469 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGTGCTACGCCATAACTCAG -3'
(R):5'- CAACAGTATGAGCCTACCAGGCAG -3'

Sequencing Primer
(F):5'- ACTTGAAAAAGAGGAACTTTCCC -3'
(R):5'- TCAGGCTAAAAGAAGCTGGTTC -3'
Posted On 2013-11-18