Incidental Mutation 'R1069:Lrguk'
ID 86125
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 039155-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R1069 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 34029448-34134034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 34048883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 205 (I205L)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000101564] [ENSMUST00000141078] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect possibly damaging
Transcript: ENSMUST00000070189
AA Change: I205L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: I205L

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101564
SMART Domains Protein: ENSMUSP00000099100
Gene: ENSMUSG00000056215

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
Pfam:LRR_1 150 170 9e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141078
SMART Domains Protein: ENSMUSP00000117680
Gene: ENSMUSG00000056215

DomainStartEndE-ValueType
Pfam:LRR_4 14 61 3.4e-8 PFAM
Pfam:LRR_1 15 35 6.1e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228187
AA Change: I205L

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.2362 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik G A 9: 41,590,298 R151H possibly damaging Het
4921524L21Rik A G 18: 6,624,037 N106S probably benign Het
Akr1c21 C A 13: 4,575,334 probably benign Het
Alpk2 G A 18: 65,305,014 R1570C probably benign Het
Atp8b3 G A 10: 80,531,018 R249C probably damaging Het
Cacnb4 C A 2: 52,455,611 R252I probably damaging Het
Cars T C 7: 143,570,107 T480A probably benign Het
Ccnf A T 17: 24,223,997 C745* probably null Het
Ccr8 A G 9: 120,094,217 I133V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dgkq T C 5: 108,656,037 probably benign Het
Ecd A G 14: 20,333,436 C312R probably damaging Het
Epp13 A T 7: 6,255,922 probably null Het
Gstm1 T C 3: 108,012,748 S226G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hacd4 T A 4: 88,437,502 I49L probably damaging Het
Hid1 T C 11: 115,356,765 N269S probably damaging Het
Ifitm3 A T 7: 141,009,900 probably benign Het
Kctd9 C T 14: 67,729,420 probably benign Het
Kif20b T C 19: 34,950,851 L1131P probably damaging Het
Kif2c T C 4: 117,178,153 T33A probably damaging Het
Lipc T C 9: 70,823,537 T38A probably benign Het
Ncapg T A 5: 45,675,930 probably benign Het
Ptprd A G 4: 75,998,487 probably benign Het
Ptprd T A 4: 76,100,633 K635* probably null Het
Sap130 G A 18: 31,711,629 V898I probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Tas2r131 C T 6: 132,957,825 R7K probably benign Het
Tfpi A G 2: 84,453,792 probably benign Het
Trim80 T C 11: 115,448,083 C580R probably damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8551:Lrguk UTSW 6 34116511 missense probably damaging 0.96
R8828:Lrguk UTSW 6 34103637 missense unknown
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCCCCAGTTCCTTCTCAAGATGGTG -3'
(R):5'- AGCATGTCCCCAGTAGGAAAGGTAG -3'

Sequencing Primer
(F):5'- CCTTCTCAAGATGGTGACAGTTAG -3'
(R):5'- gagagacagacagacagacag -3'
Posted On 2013-11-18