Mutagenetix > Incidental Mutation

Incidental Mutation 'R1069:Cars'

86129

Institutional Source

Beutler Lab

Gene Symbol

Cars

Ensembl Gene

ENSMUSG00000010755

Gene Name

cysteinyl-tRNA synthetase

Synonyms

CA3

MMRRC Submission

039155-MU

Accession Numbers

Genbank: NM_013742

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1069 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143557230-143600090 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143570107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 480 (T480A)

Ref Sequence

ENSEMBL: ENSMUSP00000010899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010899] [ENSMUST00000105909]

AlphaFold

Q9ER72

Predicted Effect

probably benign
Transcript: ENSMUST00000010899
AA Change: T480A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000010899
Gene: ENSMUSG00000010755
AA Change: T480A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1e	124	537	2.7e-128	PFAM
Blast:DALR_2	584	644	2e-13	BLAST
coiled coil region	728	768	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105909
AA Change: T397A

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101529
Gene: ENSMUSG00000010755
AA Change: T397A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1e	41	454	2e-129	PFAM
Pfam:tRNA-synt_1g	387	465	1.2e-6	PFAM
Blast:DALR_2	501	561	1e-13	BLAST
coiled coil region	645	685	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135032

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146462

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146904

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184553

Meta Mutation Damage Score

0.1561

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]

Allele List at MGI

All alleles(37) : Targeted, other(2) Gene trapped(35)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	G	A	9: 41,590,298	R151H	possibly damaging	Het
4921524L21Rik	A	G	18: 6,624,037	N106S	probably benign	Het
Akr1c21	C	A	13: 4,575,334		probably benign	Het
Alpk2	G	A	18: 65,305,014	R1570C	probably benign	Het
Atp8b3	G	A	10: 80,531,018	R249C	probably damaging	Het
Cacnb4	C	A	2: 52,455,611	R252I	probably damaging	Het
Ccnf	A	T	17: 24,223,997	C745*	probably null	Het
Ccr8	A	G	9: 120,094,217	I133V	probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Dgkq	T	C	5: 108,656,037		probably benign	Het
Ecd	A	G	14: 20,333,436	C312R	probably damaging	Het
Epp13	A	T	7: 6,255,922		probably null	Het
Gstm1	T	C	3: 108,012,748	S226G	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hacd4	T	A	4: 88,437,502	I49L	probably damaging	Het
Hid1	T	C	11: 115,356,765	N269S	probably damaging	Het
Ifitm3	A	T	7: 141,009,900		probably benign	Het
Kctd9	C	T	14: 67,729,420		probably benign	Het
Kif20b	T	C	19: 34,950,851	L1131P	probably damaging	Het
Kif2c	T	C	4: 117,178,153	T33A	probably damaging	Het
Lipc	T	C	9: 70,823,537	T38A	probably benign	Het
Lrguk	A	C	6: 34,048,883	I205L	possibly damaging	Het
Ncapg	T	A	5: 45,675,930		probably benign	Het
Ptprd	A	G	4: 75,998,487		probably benign	Het
Ptprd	T	A	4: 76,100,633	K635*	probably null	Het
Sap130	G	A	18: 31,711,629	V898I	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Tas2r131	C	T	6: 132,957,825	R7K	probably benign	Het
Tfpi	A	G	2: 84,453,792		probably benign	Het
Trim80	T	C	11: 115,448,083	C580R	probably damaging	Het
Ttn	T	A	2: 76,969,929	I312F	unknown	Het

Other mutations in Cars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01155:Cars	APN	7	143569849	missense	probably benign	0.03
IGL02192:Cars	APN	7	143571588	missense	probably damaging	1.00
IGL02645:Cars	APN	7	143557909	missense	probably damaging	0.97
IGL02807:Cars	APN	7	143569472	missense	possibly damaging	0.87
IGL02860:Cars	APN	7	143586421	missense	probably damaging	1.00
IGL03005:Cars	APN	7	143559169	missense	probably damaging	1.00
Vroom	UTSW	7	143570648	missense	probably damaging	1.00
Zoom	UTSW	7	143592625	nonsense	probably null
BB001:Cars	UTSW	7	143569871	missense	possibly damaging	0.88
BB011:Cars	UTSW	7	143569871	missense	possibly damaging	0.88
F5493:Cars	UTSW	7	143569871	missense	probably damaging	1.00
R0358:Cars	UTSW	7	143588482	splice site	probably benign
R0452:Cars	UTSW	7	143592625	nonsense	probably null
R0717:Cars	UTSW	7	143584755	missense	probably damaging	0.98
R0930:Cars	UTSW	7	143570570	missense	probably damaging	1.00
R1184:Cars	UTSW	7	143587139	missense	probably damaging	1.00
R1503:Cars	UTSW	7	143568989	missense	probably benign	0.04
R1755:Cars	UTSW	7	143569457	missense	probably damaging	1.00
R1762:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R1783:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R1786:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R1828:Cars	UTSW	7	143576648	missense	probably damaging	0.97
R2084:Cars	UTSW	7	143587182	missense	probably benign	0.03
R2132:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R2133:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R2397:Cars	UTSW	7	143592507	missense	possibly damaging	0.61
R4012:Cars	UTSW	7	143559674	missense	possibly damaging	0.65
R4057:Cars	UTSW	7	143570648	missense	probably damaging	1.00
R4082:Cars	UTSW	7	143569497	missense	probably damaging	1.00
R4118:Cars	UTSW	7	143559647	critical splice donor site	probably null
R4527:Cars	UTSW	7	143565049	missense	probably benign	0.22
R4663:Cars	UTSW	7	143575960	missense	probably damaging	1.00
R4758:Cars	UTSW	7	143571567	missense	probably benign	0.01
R4820:Cars	UTSW	7	143570564	missense	probably damaging	1.00
R4921:Cars	UTSW	7	143569475	missense	probably damaging	1.00
R4923:Cars	UTSW	7	143569850	missense	probably damaging	0.97
R5512:Cars	UTSW	7	143570133	missense	possibly damaging	0.91
R6505:Cars	UTSW	7	143565007	missense	probably damaging	1.00
R7125:Cars	UTSW	7	143584773	missense	probably benign	0.01
R7641:Cars	UTSW	7	143587103	critical splice donor site	probably null
R7674:Cars	UTSW	7	143587103	critical splice donor site	probably null
R7812:Cars	UTSW	7	143570047	missense	probably damaging	1.00
R7924:Cars	UTSW	7	143569871	missense	possibly damaging	0.88
R8260:Cars	UTSW	7	143585709	missense	probably benign
R8447:Cars	UTSW	7	143570029	missense	possibly damaging	0.67
R8905:Cars	UTSW	7	143586459	missense	probably damaging	1.00
R9200:Cars	UTSW	7	143575917	critical splice donor site	probably null
R9240:Cars	UTSW	7	143584796	missense	probably benign	0.01
R9441:Cars	UTSW	7	143569448	missense	probably benign	0.00
R9566:Cars	UTSW	7	143559647	critical splice donor site	probably null
R9603:Cars	UTSW	7	143559192	missense	possibly damaging	0.83
X0021:Cars	UTSW	7	143576584	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACACATGGCTGCCATTATTCCCAAG -3'
(R):5'- GAATCCCAGTGATAACAGCCTGACC -3'

Sequencing Primer
(F):5'- GAGTGCTTCTTCAAGGCATC -3'
(R):5'- TAGGTTCAAGCAAGTCCTGC -3'

Posted On

2013-11-18