Mutagenetix > Incidental Mutation

Incidental Mutation 'R1069:Trim80'

86135

Institutional Source

Beutler Lab

Gene Symbol

Trim80

Ensembl Gene

ENSMUSG00000070332

Gene Name

tripartite motif-containing 80

Synonyms

4933422H20Rik

MMRRC Submission

039155-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R1069 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115440545-115448270 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115448083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 580 (C580R)

Ref Sequence

ENSEMBL: ENSMUSP00000091442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093914]

AlphaFold

Q3V061

Predicted Effect

probably damaging
Transcript: ENSMUST00000093914
AA Change: C580R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091442
Gene: ENSMUSG00000070332
AA Change: C580R

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RING	71	114	4.48e-7	SMART
Blast:BBOX	154	202	7e-22	BLAST
Pfam:zf-B_box	207	246	2.2e-10	PFAM
Blast:PRY	441	496	2e-18	BLAST
Pfam:SPRY	499	621	3.9e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175355

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

100% (33/33)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	G	A	9: 41,590,298	R151H	possibly damaging	Het
4921524L21Rik	A	G	18: 6,624,037	N106S	probably benign	Het
Akr1c21	C	A	13: 4,575,334		probably benign	Het
Alpk2	G	A	18: 65,305,014	R1570C	probably benign	Het
Atp8b3	G	A	10: 80,531,018	R249C	probably damaging	Het
Cacnb4	C	A	2: 52,455,611	R252I	probably damaging	Het
Cars	T	C	7: 143,570,107	T480A	probably benign	Het
Ccnf	A	T	17: 24,223,997	C745*	probably null	Het
Ccr8	A	G	9: 120,094,217	I133V	probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Dgkq	T	C	5: 108,656,037		probably benign	Het
Ecd	A	G	14: 20,333,436	C312R	probably damaging	Het
Epp13	A	T	7: 6,255,922		probably null	Het
Gstm1	T	C	3: 108,012,748	S226G	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hacd4	T	A	4: 88,437,502	I49L	probably damaging	Het
Hid1	T	C	11: 115,356,765	N269S	probably damaging	Het
Ifitm3	A	T	7: 141,009,900		probably benign	Het
Kctd9	C	T	14: 67,729,420		probably benign	Het
Kif20b	T	C	19: 34,950,851	L1131P	probably damaging	Het
Kif2c	T	C	4: 117,178,153	T33A	probably damaging	Het
Lipc	T	C	9: 70,823,537	T38A	probably benign	Het
Lrguk	A	C	6: 34,048,883	I205L	possibly damaging	Het
Ncapg	T	A	5: 45,675,930		probably benign	Het
Ptprd	A	G	4: 75,998,487		probably benign	Het
Ptprd	T	A	4: 76,100,633	K635*	probably null	Het
Sap130	G	A	18: 31,711,629	V898I	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Tas2r131	C	T	6: 132,957,825	R7K	probably benign	Het
Tfpi	A	G	2: 84,453,792		probably benign	Het
Ttn	T	A	2: 76,969,929	I312F	unknown	Het

Other mutations in Trim80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Trim80	APN	11	115447665	missense	probably benign	0.21
IGL00921:Trim80	APN	11	115447664	missense	probably benign	0.00
IGL02948:Trim80	APN	11	115441593	missense	possibly damaging	0.81
IGL03037:Trim80	APN	11	115441593	missense	possibly damaging	0.81
R0019:Trim80	UTSW	11	115447942	missense	probably damaging	1.00
R0019:Trim80	UTSW	11	115447942	missense	probably damaging	1.00
R0409:Trim80	UTSW	11	115441213	missense	probably damaging	1.00
R1832:Trim80	UTSW	11	115446793	missense	probably benign
R1952:Trim80	UTSW	11	115441329	nonsense	probably null
R2892:Trim80	UTSW	11	115448023	missense	possibly damaging	0.81
R4301:Trim80	UTSW	11	115445113	critical splice donor site	probably null
R4748:Trim80	UTSW	11	115448138	missense	possibly damaging	0.84
R4795:Trim80	UTSW	11	115447943	missense	probably damaging	1.00
R4819:Trim80	UTSW	11	115447943	missense	probably damaging	1.00
R4910:Trim80	UTSW	11	115446455	missense	probably damaging	0.99
R5245:Trim80	UTSW	11	115441572	missense	probably damaging	1.00
R5288:Trim80	UTSW	11	115448017	missense	probably benign	0.07
R5384:Trim80	UTSW	11	115448017	missense	probably benign	0.07
R5386:Trim80	UTSW	11	115448017	missense	probably benign	0.07
R5508:Trim80	UTSW	11	115445078	missense	probably benign	0.06
R5645:Trim80	UTSW	11	115446785	missense	probably damaging	1.00
R5785:Trim80	UTSW	11	115446475	nonsense	probably null
R5822:Trim80	UTSW	11	115447921	missense	probably damaging	0.99
R6754:Trim80	UTSW	11	115448174	missense	probably damaging	1.00
R6785:Trim80	UTSW	11	115441201	missense	probably damaging	0.99
R6788:Trim80	UTSW	11	115448017	missense	probably benign	0.07
R7336:Trim80	UTSW	11	115441216	missense	probably damaging	1.00
R8316:Trim80	UTSW	11	115441180	missense	probably damaging	1.00
R8386:Trim80	UTSW	11	115445074	missense	probably damaging	0.99
R8955:Trim80	UTSW	11	115440712	missense	probably benign
R9764:Trim80	UTSW	11	115447931	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- TCGCAACATCGTCTACCTGCTG -3'
(R):5'- TGGGCCACCGACTTTCATTCTTAAC -3'

Sequencing Primer
(F):5'- GTCTACCTGCTGGGCCG -3'
(R):5'- TTCTGCCCTGGGAACAATGAC -3'

Posted On

2013-11-18