Incidental Mutation 'R1069:Trim80'
ID86135
Institutional Source Beutler Lab
Gene Symbol Trim80
Ensembl Gene ENSMUSG00000070332
Gene Nametripartite motif-containing 80
Synonyms4933422H20Rik
MMRRC Submission 039155-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1069 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115440545-115448270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115448083 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 580 (C580R)
Ref Sequence ENSEMBL: ENSMUSP00000091442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093914]
Predicted Effect probably damaging
Transcript: ENSMUST00000093914
AA Change: C580R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091442
Gene: ENSMUSG00000070332
AA Change: C580R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RING 71 114 4.48e-7 SMART
Blast:BBOX 154 202 7e-22 BLAST
Pfam:zf-B_box 207 246 2.2e-10 PFAM
Blast:PRY 441 496 2e-18 BLAST
Pfam:SPRY 499 621 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175355
Meta Mutation Damage Score 0.0408 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik G A 9: 41,590,298 R151H possibly damaging Het
4921524L21Rik A G 18: 6,624,037 N106S probably benign Het
Akr1c21 C A 13: 4,575,334 probably benign Het
Alpk2 G A 18: 65,305,014 R1570C probably benign Het
Atp8b3 G A 10: 80,531,018 R249C probably damaging Het
Cacnb4 C A 2: 52,455,611 R252I probably damaging Het
Cars T C 7: 143,570,107 T480A probably benign Het
Ccnf A T 17: 24,223,997 C745* probably null Het
Ccr8 A G 9: 120,094,217 I133V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dgkq T C 5: 108,656,037 probably benign Het
Ecd A G 14: 20,333,436 C312R probably damaging Het
Epp13 A T 7: 6,255,922 probably null Het
Gstm1 T C 3: 108,012,748 S226G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hacd4 T A 4: 88,437,502 I49L probably damaging Het
Hid1 T C 11: 115,356,765 N269S probably damaging Het
Ifitm3 A T 7: 141,009,900 probably benign Het
Kctd9 C T 14: 67,729,420 probably benign Het
Kif20b T C 19: 34,950,851 L1131P probably damaging Het
Kif2c T C 4: 117,178,153 T33A probably damaging Het
Lipc T C 9: 70,823,537 T38A probably benign Het
Lrguk A C 6: 34,048,883 I205L possibly damaging Het
Ncapg T A 5: 45,675,930 probably benign Het
Ptprd A G 4: 75,998,487 probably benign Het
Ptprd T A 4: 76,100,633 K635* probably null Het
Sap130 G A 18: 31,711,629 V898I probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Tas2r131 C T 6: 132,957,825 R7K probably benign Het
Tfpi A G 2: 84,453,792 probably benign Het
Ttn T A 2: 76,969,929 I312F probably benign Het
Other mutations in Trim80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Trim80 APN 11 115447665 missense probably benign 0.21
IGL00921:Trim80 APN 11 115447664 missense probably benign 0.00
IGL02948:Trim80 APN 11 115441593 missense possibly damaging 0.81
IGL03037:Trim80 APN 11 115441593 missense possibly damaging 0.81
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0409:Trim80 UTSW 11 115441213 missense probably damaging 1.00
R1832:Trim80 UTSW 11 115446793 missense probably benign
R1952:Trim80 UTSW 11 115441329 nonsense probably null
R2892:Trim80 UTSW 11 115448023 missense possibly damaging 0.81
R4301:Trim80 UTSW 11 115445113 critical splice donor site probably null
R4748:Trim80 UTSW 11 115448138 missense possibly damaging 0.84
R4795:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4819:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4910:Trim80 UTSW 11 115446455 missense probably damaging 0.99
R5245:Trim80 UTSW 11 115441572 missense probably damaging 1.00
R5288:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5384:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5386:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5508:Trim80 UTSW 11 115445078 missense probably benign 0.06
R5645:Trim80 UTSW 11 115446785 missense probably damaging 1.00
R5785:Trim80 UTSW 11 115446475 nonsense probably null
R5822:Trim80 UTSW 11 115447921 missense probably damaging 0.99
R6754:Trim80 UTSW 11 115448174 missense probably damaging 1.00
R6785:Trim80 UTSW 11 115441201 missense probably damaging 0.99
R6788:Trim80 UTSW 11 115448017 missense probably benign 0.07
R7336:Trim80 UTSW 11 115441216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCAACATCGTCTACCTGCTG -3'
(R):5'- TGGGCCACCGACTTTCATTCTTAAC -3'

Sequencing Primer
(F):5'- GTCTACCTGCTGGGCCG -3'
(R):5'- TTCTGCCCTGGGAACAATGAC -3'
Posted On2013-11-18