Incidental Mutation 'R1069:Akr1c21'
ID 86136
Institutional Source Beutler Lab
Gene Symbol Akr1c21
Ensembl Gene ENSMUSG00000021207
Gene Name aldo-keto reductase family 1, member C21
Synonyms
MMRRC Submission 039155-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1069 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 4574075-4586541 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 4575334 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021628] [ENSMUST00000223285]
AlphaFold Q91WR5
Predicted Effect probably benign
Transcript: ENSMUST00000021628
SMART Domains Protein: ENSMUSP00000021628
Gene: ENSMUSG00000021207

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137279
Predicted Effect probably benign
Transcript: ENSMUST00000223285
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik G A 9: 41,590,298 R151H possibly damaging Het
4921524L21Rik A G 18: 6,624,037 N106S probably benign Het
Alpk2 G A 18: 65,305,014 R1570C probably benign Het
Atp8b3 G A 10: 80,531,018 R249C probably damaging Het
Cacnb4 C A 2: 52,455,611 R252I probably damaging Het
Cars T C 7: 143,570,107 T480A probably benign Het
Ccnf A T 17: 24,223,997 C745* probably null Het
Ccr8 A G 9: 120,094,217 I133V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dgkq T C 5: 108,656,037 probably benign Het
Ecd A G 14: 20,333,436 C312R probably damaging Het
Epp13 A T 7: 6,255,922 probably null Het
Gstm1 T C 3: 108,012,748 S226G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hacd4 T A 4: 88,437,502 I49L probably damaging Het
Hid1 T C 11: 115,356,765 N269S probably damaging Het
Ifitm3 A T 7: 141,009,900 probably benign Het
Kctd9 C T 14: 67,729,420 probably benign Het
Kif20b T C 19: 34,950,851 L1131P probably damaging Het
Kif2c T C 4: 117,178,153 T33A probably damaging Het
Lipc T C 9: 70,823,537 T38A probably benign Het
Lrguk A C 6: 34,048,883 I205L possibly damaging Het
Ncapg T A 5: 45,675,930 probably benign Het
Ptprd A G 4: 75,998,487 probably benign Het
Ptprd T A 4: 76,100,633 K635* probably null Het
Sap130 G A 18: 31,711,629 V898I probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Tas2r131 C T 6: 132,957,825 R7K probably benign Het
Tfpi A G 2: 84,453,792 probably benign Het
Trim80 T C 11: 115,448,083 C580R probably damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Other mutations in Akr1c21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Akr1c21 APN 13 4576313 missense probably damaging 1.00
IGL01093:Akr1c21 APN 13 4581140 splice site probably benign
IGL01408:Akr1c21 APN 13 4577432 missense probably benign
IGL02470:Akr1c21 APN 13 4577407 missense probably damaging 1.00
IGL02683:Akr1c21 APN 13 4576313 missense probably damaging 1.00
IGL02738:Akr1c21 APN 13 4580301 missense probably damaging 1.00
IGL03126:Akr1c21 APN 13 4577458 missense possibly damaging 0.76
IGL03365:Akr1c21 APN 13 4583852 missense probably benign 0.00
R0166:Akr1c21 UTSW 13 4581264 missense probably damaging 1.00
R0391:Akr1c21 UTSW 13 4581200 missense probably damaging 1.00
R0505:Akr1c21 UTSW 13 4576307 missense probably damaging 1.00
R1168:Akr1c21 UTSW 13 4583837 missense probably benign 0.04
R1617:Akr1c21 UTSW 13 4576352 splice site probably null
R1686:Akr1c21 UTSW 13 4577453 missense probably damaging 1.00
R1694:Akr1c21 UTSW 13 4575178 missense probably damaging 0.98
R1753:Akr1c21 UTSW 13 4577135 nonsense probably null
R1977:Akr1c21 UTSW 13 4574212 missense probably damaging 1.00
R2005:Akr1c21 UTSW 13 4574215 missense probably damaging 1.00
R2036:Akr1c21 UTSW 13 4576306 missense probably damaging 0.98
R2198:Akr1c21 UTSW 13 4577465 missense probably damaging 1.00
R2925:Akr1c21 UTSW 13 4576350 splice site probably null
R4965:Akr1c21 UTSW 13 4580305 missense probably damaging 1.00
R6245:Akr1c21 UTSW 13 4575232 missense possibly damaging 0.93
R6381:Akr1c21 UTSW 13 4574184 missense probably damaging 1.00
R6711:Akr1c21 UTSW 13 4577375 missense probably damaging 1.00
R6843:Akr1c21 UTSW 13 4575214 missense probably damaging 1.00
R6998:Akr1c21 UTSW 13 4583851 missense probably benign 0.05
R7253:Akr1c21 UTSW 13 4577140 missense probably damaging 1.00
R7475:Akr1c21 UTSW 13 4576319 missense probably benign 0.09
R8389:Akr1c21 UTSW 13 4576279 missense probably damaging 0.96
R8391:Akr1c21 UTSW 13 4576279 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGATTGACTCACTCTTGTTACCCCAT -3'
(R):5'- AGACTTCTCTTTCCCATAGTCCGGTTTA -3'

Sequencing Primer
(F):5'- CAGAGAAGGTCATATTTTGTGCCTC -3'
(R):5'- CATAGTCCGGTTTACATCATATTGC -3'
Posted On 2013-11-18