Mutagenetix > Incidental Mutation

Incidental Mutation 'R1069:Ccnf'

86139

Institutional Source

Beutler Lab

Gene Symbol

Ccnf

Ensembl Gene

ENSMUSG00000072082

Gene Name

cyclin F

Synonyms

Fbxo1, CycF

MMRRC Submission

039155-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1069 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24223232-24251409 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 24223997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 745 (C745*)

Ref Sequence

ENSEMBL: ENSMUSP00000111048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024930] [ENSMUST00000115390]

AlphaFold

P51944

Predicted Effect

probably benign
Transcript: ENSMUST00000024930

SMART Domains

Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118

Domain	Start	End	E-Value	Type
low complexity region	32	49	N/A	INTRINSIC
low complexity region	78	84	N/A	INTRINSIC
low complexity region	111	131	N/A	INTRINSIC
Pfam:DUF4693	150	434	8.6e-145	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115390
AA Change: C745*

SMART Domains

Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: C745*

Domain	Start	End	E-Value	Type
FBOX	35	75	1.56e-6	SMART
CYCLIN	315	399	2.25e-13	SMART
Cyclin_C	408	531	2.58e-19	SMART
CYCLIN	416	494	2.27e-9	SMART
low complexity region	545	555	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	695	708	N/A	INTRINSIC
low complexity region	719	731	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124557

SMART Domains

Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118

Domain	Start	End	E-Value	Type
low complexity region	16	32	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137648

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138818

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148704

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149916

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171563

Meta Mutation Damage Score

0.9712

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	G	A	9: 41,590,298	R151H	possibly damaging	Het
4921524L21Rik	A	G	18: 6,624,037	N106S	probably benign	Het
Akr1c21	C	A	13: 4,575,334		probably benign	Het
Alpk2	G	A	18: 65,305,014	R1570C	probably benign	Het
Atp8b3	G	A	10: 80,531,018	R249C	probably damaging	Het
Cacnb4	C	A	2: 52,455,611	R252I	probably damaging	Het
Cars	T	C	7: 143,570,107	T480A	probably benign	Het
Ccr8	A	G	9: 120,094,217	I133V	probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Dgkq	T	C	5: 108,656,037		probably benign	Het
Ecd	A	G	14: 20,333,436	C312R	probably damaging	Het
Epp13	A	T	7: 6,255,922		probably null	Het
Gstm1	T	C	3: 108,012,748	S226G	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hacd4	T	A	4: 88,437,502	I49L	probably damaging	Het
Hid1	T	C	11: 115,356,765	N269S	probably damaging	Het
Ifitm3	A	T	7: 141,009,900		probably benign	Het
Kctd9	C	T	14: 67,729,420		probably benign	Het
Kif20b	T	C	19: 34,950,851	L1131P	probably damaging	Het
Kif2c	T	C	4: 117,178,153	T33A	probably damaging	Het
Lipc	T	C	9: 70,823,537	T38A	probably benign	Het
Lrguk	A	C	6: 34,048,883	I205L	possibly damaging	Het
Ncapg	T	A	5: 45,675,930		probably benign	Het
Ptprd	A	G	4: 75,998,487		probably benign	Het
Ptprd	T	A	4: 76,100,633	K635*	probably null	Het
Sap130	G	A	18: 31,711,629	V898I	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Tas2r131	C	T	6: 132,957,825	R7K	probably benign	Het
Tfpi	A	G	2: 84,453,792		probably benign	Het
Trim80	T	C	11: 115,448,083	C580R	probably damaging	Het
Ttn	T	A	2: 76,969,929	I312F	unknown	Het

Other mutations in Ccnf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Ccnf	APN	17	24225012	missense	probably damaging	1.00
IGL01942:Ccnf	APN	17	24242320	missense	probably benign	0.03
IGL02251:Ccnf	APN	17	24226539	missense	probably benign	0.00
IGL02945:Ccnf	APN	17	24224916	missense	probably damaging	0.99
IGL02952:Ccnf	APN	17	24231325	missense	possibly damaging	0.93
albuquerque	UTSW	17	24223997	nonsense	probably null
R0326:Ccnf	UTSW	17	24231810	missense	possibly damaging	0.84
R0891:Ccnf	UTSW	17	24226777	missense	possibly damaging	0.93
R1072:Ccnf	UTSW	17	24237162	missense	probably damaging	0.97
R1693:Ccnf	UTSW	17	24226540	frame shift	probably null
R2147:Ccnf	UTSW	17	24230314	critical splice donor site	probably null
R3929:Ccnf	UTSW	17	24234382	missense	probably damaging	1.00
R4081:Ccnf	UTSW	17	24223898	makesense	probably null
R4260:Ccnf	UTSW	17	24226767	missense	probably damaging	1.00
R4579:Ccnf	UTSW	17	24231329	nonsense	probably null
R4651:Ccnf	UTSW	17	24231786	missense	probably damaging	1.00
R4844:Ccnf	UTSW	17	24230357	nonsense	probably null
R4876:Ccnf	UTSW	17	24230337	missense	probably damaging	1.00
R5234:Ccnf	UTSW	17	24234437	nonsense	probably null
R5352:Ccnf	UTSW	17	24243273	splice site	probably null
R5845:Ccnf	UTSW	17	24240793	missense	possibly damaging	0.95
R6084:Ccnf	UTSW	17	24231837	missense	probably damaging	1.00
R6219:Ccnf	UTSW	17	24226704	nonsense	probably null
R7021:Ccnf	UTSW	17	24242231	missense	probably damaging	1.00
R7176:Ccnf	UTSW	17	24249402	missense	possibly damaging	0.54
R7180:Ccnf	UTSW	17	24223915	missense	probably benign	0.00
R7485:Ccnf	UTSW	17	24249258	missense	probably damaging	0.97
R7763:Ccnf	UTSW	17	24225012	missense	probably damaging	1.00
R8016:Ccnf	UTSW	17	24231810	missense	possibly damaging	0.84
R8034:Ccnf	UTSW	17	24231831	missense	probably damaging	1.00
R8069:Ccnf	UTSW	17	24225015	missense	probably damaging	1.00
R9021:Ccnf	UTSW	17	24226705	nonsense	probably null
R9623:Ccnf	UTSW	17	24249393	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTCCTAGAGAAACAGCAGCCC -3'
(R):5'- TGAACCCAGAAGAACATTGCTGCC -3'

Sequencing Primer
(F):5'- GCCCTCCCTCAGTAAACATTC -3'
(R):5'- AACATTGCTGCCAGGAGTC -3'

Posted On

2013-11-18