Incidental Mutation 'R1069:Sap130'
ID86141
Institutional Source Beutler Lab
Gene Symbol Sap130
Ensembl Gene ENSMUSG00000024260
Gene NameSin3A associated protein
Synonyms2610304F09Rik
MMRRC Submission 039155-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R1069 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location31634371-31723061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31711629 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 898 (V898I)
Ref Sequence ENSEMBL: ENSMUSP00000136842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025109] [ENSMUST00000178164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025109
AA Change: V897I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025109
Gene: ENSMUSG00000024260
AA Change: V897I

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
low complexity region 716 748 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 894 904 N/A INTRINSIC
low complexity region 1044 1056 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178164
AA Change: V898I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136842
Gene: ENSMUSG00000024260
AA Change: V898I

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
Pfam:SAP130_C 635 1040 5.4e-224 PFAM
low complexity region 1045 1057 N/A INTRINSIC
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAP130 is a subunit of the histone deacetylase (see HDAC1; MIM 601241)-dependent SIN3A (MIM 607776) corepressor complex (Fleischer et al., 2003 [PubMed 12724404]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a transposon insertion are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik G A 9: 41,590,298 R151H possibly damaging Het
4921524L21Rik A G 18: 6,624,037 N106S probably benign Het
Akr1c21 C A 13: 4,575,334 probably benign Het
Alpk2 G A 18: 65,305,014 R1570C probably benign Het
Atp8b3 G A 10: 80,531,018 R249C probably damaging Het
Cacnb4 C A 2: 52,455,611 R252I probably damaging Het
Cars T C 7: 143,570,107 T480A probably benign Het
Ccnf A T 17: 24,223,997 C745* probably null Het
Ccr8 A G 9: 120,094,217 I133V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dgkq T C 5: 108,656,037 probably benign Het
Ecd A G 14: 20,333,436 C312R probably damaging Het
Epp13 A T 7: 6,255,922 probably null Het
Gstm1 T C 3: 108,012,748 S226G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hacd4 T A 4: 88,437,502 I49L probably damaging Het
Hid1 T C 11: 115,356,765 N269S probably damaging Het
Ifitm3 A T 7: 141,009,900 probably benign Het
Kctd9 C T 14: 67,729,420 probably benign Het
Kif20b T C 19: 34,950,851 L1131P probably damaging Het
Kif2c T C 4: 117,178,153 T33A probably damaging Het
Lipc T C 9: 70,823,537 T38A probably benign Het
Lrguk A C 6: 34,048,883 I205L possibly damaging Het
Ncapg T A 5: 45,675,930 probably benign Het
Ptprd A G 4: 75,998,487 probably benign Het
Ptprd T A 4: 76,100,633 K635* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Tas2r131 C T 6: 132,957,825 R7K probably benign Het
Tfpi A G 2: 84,453,792 probably benign Het
Trim80 T C 11: 115,448,083 C580R probably damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Other mutations in Sap130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Sap130 APN 18 31698766 missense probably benign 0.00
IGL01060:Sap130 APN 18 31715443 missense probably damaging 1.00
IGL01668:Sap130 APN 18 31680440 missense probably damaging 0.97
IGL01797:Sap130 APN 18 31698668 missense probably damaging 0.98
IGL01872:Sap130 APN 18 31674420 missense probably damaging 0.98
IGL02010:Sap130 APN 18 31649602 missense probably damaging 0.98
PIT4142001:Sap130 UTSW 18 31667011 critical splice donor site probably null
PIT4366001:Sap130 UTSW 18 31677409 missense probably benign 0.06
R0083:Sap130 UTSW 18 31711641 missense probably damaging 1.00
R0083:Sap130 UTSW 18 31666329 splice site probably benign
R0243:Sap130 UTSW 18 31680681 splice site probably benign
R0255:Sap130 UTSW 18 31680506 missense probably damaging 1.00
R0704:Sap130 UTSW 18 31653554 missense probably damaging 0.99
R1086:Sap130 UTSW 18 31650620 splice site probably benign
R1162:Sap130 UTSW 18 31648173 missense probably damaging 1.00
R1478:Sap130 UTSW 18 31680474 missense possibly damaging 0.95
R1484:Sap130 UTSW 18 31711327 missense probably damaging 1.00
R1554:Sap130 UTSW 18 31666472 missense probably damaging 0.99
R1625:Sap130 UTSW 18 31674464 missense probably damaging 0.99
R1771:Sap130 UTSW 18 31636082 missense probably benign 0.10
R1793:Sap130 UTSW 18 31698587 missense probably benign 0.10
R1905:Sap130 UTSW 18 31680567 missense possibly damaging 0.67
R2026:Sap130 UTSW 18 31698574 missense possibly damaging 0.81
R2074:Sap130 UTSW 18 31648279 missense probably damaging 0.99
R2174:Sap130 UTSW 18 31677479 critical splice donor site probably null
R3927:Sap130 UTSW 18 31674382 missense possibly damaging 0.95
R4454:Sap130 UTSW 18 31711360 missense probably damaging 1.00
R4980:Sap130 UTSW 18 31649646 missense possibly damaging 0.95
R5222:Sap130 UTSW 18 31666703 missense probably damaging 1.00
R5345:Sap130 UTSW 18 31648198 missense probably benign 0.32
R5811:Sap130 UTSW 18 31689442 missense probably benign 0.01
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6129:Sap130 UTSW 18 31682091 missense possibly damaging 0.94
R6431:Sap130 UTSW 18 31666365 missense possibly damaging 0.95
R6930:Sap130 UTSW 18 31682088 missense possibly damaging 0.94
R6932:Sap130 UTSW 18 31666354 missense possibly damaging 0.88
R7454:Sap130 UTSW 18 31650512 missense probably benign 0.01
R7510:Sap130 UTSW 18 31667004 missense probably damaging 1.00
R7510:Sap130 UTSW 18 31711215 missense probably damaging 0.99
R7641:Sap130 UTSW 18 31653623 missense probably damaging 0.99
R7870:Sap130 UTSW 18 31720661 missense probably benign 0.15
R7953:Sap130 UTSW 18 31720661 missense probably benign 0.15
X0021:Sap130 UTSW 18 31647076 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGAAGTCCGCTGCCAAGAGTC -3'
(R):5'- GTACTTGAGGAGCTGTCAGCACAC -3'

Sequencing Primer
(F):5'- CTGCCAAGAGTCTCCTGGTAAAG -3'
(R):5'- GCTGTCAGCACACAGAATG -3'
Posted On2013-11-18