Incidental Mutation 'R1069:Cndp1'
ID 86143
Institutional Source Beutler Lab
Gene Symbol Cndp1
Ensembl Gene ENSMUSG00000056162
Gene Name carnosine dipeptidase 1 (metallopeptidase M20 family)
Synonyms Cn1
MMRRC Submission 039155-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R1069 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 84610509-84650084 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 84634652 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070139]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070139
SMART Domains Protein: ENSMUSP00000069699
Gene: ENSMUSG00000056162

DomainStartEndE-ValueType
Pfam:Peptidase_M20 103 477 4.3e-33 PFAM
Pfam:M20_dimer 216 377 3.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145981
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik G A 9: 41,590,298 R151H possibly damaging Het
4921524L21Rik A G 18: 6,624,037 N106S probably benign Het
Akr1c21 C A 13: 4,575,334 probably benign Het
Alpk2 G A 18: 65,305,014 R1570C probably benign Het
Atp8b3 G A 10: 80,531,018 R249C probably damaging Het
Cacnb4 C A 2: 52,455,611 R252I probably damaging Het
Cars T C 7: 143,570,107 T480A probably benign Het
Ccnf A T 17: 24,223,997 C745* probably null Het
Ccr8 A G 9: 120,094,217 I133V probably benign Het
Dgkq T C 5: 108,656,037 probably benign Het
Ecd A G 14: 20,333,436 C312R probably damaging Het
Epp13 A T 7: 6,255,922 probably null Het
Gstm1 T C 3: 108,012,748 S226G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hacd4 T A 4: 88,437,502 I49L probably damaging Het
Hid1 T C 11: 115,356,765 N269S probably damaging Het
Ifitm3 A T 7: 141,009,900 probably benign Het
Kctd9 C T 14: 67,729,420 probably benign Het
Kif20b T C 19: 34,950,851 L1131P probably damaging Het
Kif2c T C 4: 117,178,153 T33A probably damaging Het
Lipc T C 9: 70,823,537 T38A probably benign Het
Lrguk A C 6: 34,048,883 I205L possibly damaging Het
Ncapg T A 5: 45,675,930 probably benign Het
Ptprd A G 4: 75,998,487 probably benign Het
Ptprd T A 4: 76,100,633 K635* probably null Het
Sap130 G A 18: 31,711,629 V898I probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Tas2r131 C T 6: 132,957,825 R7K probably benign Het
Tfpi A G 2: 84,453,792 probably benign Het
Trim80 T C 11: 115,448,083 C580R probably damaging Het
Ttn T A 2: 76,969,929 I312F unknown Het
Other mutations in Cndp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Cndp1 APN 18 84611665 missense probably benign 0.05
IGL01326:Cndp1 APN 18 84622232 missense probably benign 0.01
IGL01762:Cndp1 APN 18 84622286 missense probably damaging 1.00
IGL02061:Cndp1 APN 18 84634626 missense probably damaging 1.00
IGL02731:Cndp1 APN 18 84631958 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0285:Cndp1 UTSW 18 84618238 missense possibly damaging 0.72
R0494:Cndp1 UTSW 18 84619533 missense probably benign 0.01
R0967:Cndp1 UTSW 18 84634652 splice site probably benign
R0968:Cndp1 UTSW 18 84634652 splice site probably benign
R0969:Cndp1 UTSW 18 84634652 splice site probably benign
R1170:Cndp1 UTSW 18 84611625 missense probably benign 0.00
R1340:Cndp1 UTSW 18 84634652 splice site probably benign
R1414:Cndp1 UTSW 18 84634652 splice site probably benign
R1432:Cndp1 UTSW 18 84634652 splice site probably benign
R1891:Cndp1 UTSW 18 84619633 missense probably null 1.00
R3912:Cndp1 UTSW 18 84631999 missense probably benign 0.00
R4024:Cndp1 UTSW 18 84628813 missense probably damaging 1.00
R4238:Cndp1 UTSW 18 84618217 missense probably benign
R4564:Cndp1 UTSW 18 84622286 missense probably damaging 1.00
R4989:Cndp1 UTSW 18 84631900 missense probably damaging 0.99
R5015:Cndp1 UTSW 18 84631911 missense probably damaging 1.00
R5108:Cndp1 UTSW 18 84632061 missense probably damaging 1.00
R5502:Cndp1 UTSW 18 84632013 missense possibly damaging 0.56
R5835:Cndp1 UTSW 18 84612833 missense probably benign 0.00
R6396:Cndp1 UTSW 18 84632010 missense probably benign
R6549:Cndp1 UTSW 18 84636184 missense probably benign 0.04
R7251:Cndp1 UTSW 18 84622197 missense probably benign
R7465:Cndp1 UTSW 18 84619541 missense probably damaging 1.00
R7638:Cndp1 UTSW 18 84636049 missense probably benign 0.36
R7812:Cndp1 UTSW 18 84637869 missense probably benign
R7921:Cndp1 UTSW 18 84622258 missense probably benign 0.11
R8408:Cndp1 UTSW 18 84631924 missense possibly damaging 0.71
R8693:Cndp1 UTSW 18 84628813 missense probably damaging 1.00
R9688:Cndp1 UTSW 18 84637857 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGTGCTCCGAGAACTCCGT -3'
(R):5'- TGTGTGCTTAAACTAGCTTGTCGTGT -3'

Sequencing Primer
(F):5'- GAACTCCGTCACCTCTCTCAAG -3'
(R):5'- ACACAGGTGCGGATTGTT -3'
Posted On 2013-11-18