Incidental Mutation 'R1069:Kif20b'
ID 86144
Institutional Source Beutler Lab
Gene Symbol Kif20b
Ensembl Gene ENSMUSG00000024795
Gene Name kinesin family member 20B
Synonyms C330014J10Rik, magoo, Kif20b, N-6 kinesin, Mphosph1, 33cex
MMRRC Submission 039155-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.900) question?
Stock # R1069 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 34899761-34953145 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34928251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1131 (L1131P)
Ref Sequence ENSEMBL: ENSMUSP00000153034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223907] [ENSMUST00000223937]
AlphaFold Q80WE4
Predicted Effect probably damaging
Transcript: ENSMUST00000087341
AA Change: L1171P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795
AA Change: L1171P

DomainStartEndE-ValueType
Blast:KISc 2 46 5e-15 BLAST
KISc 56 483 1.19e-103 SMART
low complexity region 521 551 N/A INTRINSIC
coiled coil region 565 602 N/A INTRINSIC
coiled coil region 705 746 N/A INTRINSIC
coiled coil region 823 947 N/A INTRINSIC
coiled coil region 1020 1325 N/A INTRINSIC
coiled coil region 1348 1510 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223907
AA Change: L1131P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000223937
Predicted Effect probably benign
Transcript: ENSMUST00000224728
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,624,037 (GRCm39) N106S probably benign Het
Akr1c21 C A 13: 4,625,333 (GRCm39) probably benign Het
Alpk2 G A 18: 65,438,085 (GRCm39) R1570C probably benign Het
Atp8b3 G A 10: 80,366,852 (GRCm39) R249C probably damaging Het
Cacnb4 C A 2: 52,345,623 (GRCm39) R252I probably damaging Het
Cars1 T C 7: 143,123,844 (GRCm39) T480A probably benign Het
Ccnf A T 17: 24,442,971 (GRCm39) C745* probably null Het
Ccr8 A G 9: 119,923,283 (GRCm39) I133V probably benign Het
Cndp1 G A 18: 84,652,777 (GRCm39) probably benign Het
Dgkq T C 5: 108,803,903 (GRCm39) probably benign Het
Ecd A G 14: 20,383,504 (GRCm39) C312R probably damaging Het
Eddm13 A T 7: 6,258,921 (GRCm39) probably null Het
Gstm1 T C 3: 107,920,064 (GRCm39) S226G probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Hacd4 T A 4: 88,355,739 (GRCm39) I49L probably damaging Het
Hid1 T C 11: 115,247,591 (GRCm39) N269S probably damaging Het
Ifitm3 A T 7: 140,589,813 (GRCm39) probably benign Het
Kctd9 C T 14: 67,966,869 (GRCm39) probably benign Het
Kif2c T C 4: 117,035,350 (GRCm39) T33A probably damaging Het
Lipc T C 9: 70,730,819 (GRCm39) T38A probably benign Het
Lrguk A C 6: 34,025,818 (GRCm39) I205L possibly damaging Het
Mir100hg G A 9: 41,501,594 (GRCm39) R151H possibly damaging Het
Ncapg T A 5: 45,833,272 (GRCm39) probably benign Het
Ptprd A G 4: 75,916,724 (GRCm39) probably benign Het
Ptprd T A 4: 76,018,870 (GRCm39) K635* probably null Het
Sap130 G A 18: 31,844,682 (GRCm39) V898I probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Svep1 C T 4: 58,070,239 (GRCm39) G2516R probably damaging Het
Tas2r131 C T 6: 132,934,788 (GRCm39) R7K probably benign Het
Tfpi A G 2: 84,284,136 (GRCm39) probably benign Het
Trim80 T C 11: 115,338,909 (GRCm39) C580R probably damaging Het
Ttn T A 2: 76,800,273 (GRCm39) I312F unknown Het
Other mutations in Kif20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kif20b APN 19 34,925,060 (GRCm39) missense possibly damaging 0.77
IGL01021:Kif20b APN 19 34,915,660 (GRCm39) missense possibly damaging 0.89
IGL01590:Kif20b APN 19 34,932,126 (GRCm39) missense possibly damaging 0.87
IGL01691:Kif20b APN 19 34,913,143 (GRCm39) splice site probably benign
IGL01730:Kif20b APN 19 34,927,923 (GRCm39) nonsense probably null
IGL02078:Kif20b APN 19 34,913,044 (GRCm39) missense probably damaging 1.00
IGL02174:Kif20b APN 19 34,911,858 (GRCm39) splice site probably benign
IGL02536:Kif20b APN 19 34,951,959 (GRCm39) missense probably benign 0.42
IGL03029:Kif20b APN 19 34,928,313 (GRCm39) missense probably benign
IGL03186:Kif20b APN 19 34,912,344 (GRCm39) missense probably benign 0.45
IGL03205:Kif20b APN 19 34,936,863 (GRCm39) missense probably damaging 1.00
IGL03493:Kif20b APN 19 34,936,950 (GRCm39) nonsense probably null
R0319:Kif20b UTSW 19 34,925,132 (GRCm39) splice site probably benign
R1137:Kif20b UTSW 19 34,914,486 (GRCm39) critical splice donor site probably null
R1255:Kif20b UTSW 19 34,927,506 (GRCm39) missense probably benign 0.08
R1352:Kif20b UTSW 19 34,902,035 (GRCm39) missense probably benign
R1466:Kif20b UTSW 19 34,927,999 (GRCm39) missense probably benign 0.00
R1466:Kif20b UTSW 19 34,927,999 (GRCm39) missense probably benign 0.00
R1473:Kif20b UTSW 19 34,951,896 (GRCm39) missense possibly damaging 0.93
R1545:Kif20b UTSW 19 34,906,318 (GRCm39) missense probably damaging 1.00
R1647:Kif20b UTSW 19 34,914,190 (GRCm39) missense possibly damaging 0.65
R1648:Kif20b UTSW 19 34,914,190 (GRCm39) missense possibly damaging 0.65
R1752:Kif20b UTSW 19 34,915,736 (GRCm39) missense probably benign 0.13
R1835:Kif20b UTSW 19 34,933,438 (GRCm39) missense probably damaging 1.00
R1889:Kif20b UTSW 19 34,918,608 (GRCm39) unclassified probably benign
R1937:Kif20b UTSW 19 34,930,278 (GRCm39) missense possibly damaging 0.73
R2112:Kif20b UTSW 19 34,909,132 (GRCm39) missense probably benign 0.04
R2315:Kif20b UTSW 19 34,908,999 (GRCm39) missense probably damaging 1.00
R2385:Kif20b UTSW 19 34,936,819 (GRCm39) missense probably damaging 0.98
R2867:Kif20b UTSW 19 34,917,528 (GRCm39) missense probably damaging 1.00
R2867:Kif20b UTSW 19 34,917,528 (GRCm39) missense probably damaging 1.00
R3086:Kif20b UTSW 19 34,907,115 (GRCm39) missense probably damaging 1.00
R3116:Kif20b UTSW 19 34,947,480 (GRCm39) missense probably benign 0.38
R3407:Kif20b UTSW 19 34,927,900 (GRCm39) missense probably damaging 1.00
R3834:Kif20b UTSW 19 34,912,428 (GRCm39) missense probably damaging 1.00
R3882:Kif20b UTSW 19 34,927,480 (GRCm39) missense probably damaging 1.00
R4698:Kif20b UTSW 19 34,928,944 (GRCm39) missense probably damaging 1.00
R4721:Kif20b UTSW 19 34,915,773 (GRCm39) missense probably benign 0.41
R4883:Kif20b UTSW 19 34,943,522 (GRCm39) missense probably benign 0.00
R4901:Kif20b UTSW 19 34,911,836 (GRCm39) missense probably benign 0.00
R4923:Kif20b UTSW 19 34,918,611 (GRCm39) critical splice acceptor site probably null
R5538:Kif20b UTSW 19 34,930,364 (GRCm39) nonsense probably null
R5540:Kif20b UTSW 19 34,915,860 (GRCm39) missense probably benign 0.01
R5558:Kif20b UTSW 19 34,928,949 (GRCm39) missense probably damaging 1.00
R5580:Kif20b UTSW 19 34,927,128 (GRCm39) splice site probably null
R5934:Kif20b UTSW 19 34,918,721 (GRCm39) missense probably benign 0.02
R6019:Kif20b UTSW 19 34,927,864 (GRCm39) missense probably benign 0.00
R6464:Kif20b UTSW 19 34,911,841 (GRCm39) missense probably benign
R6613:Kif20b UTSW 19 34,914,384 (GRCm39) nonsense probably null
R6745:Kif20b UTSW 19 34,906,276 (GRCm39) missense possibly damaging 0.94
R7097:Kif20b UTSW 19 34,951,892 (GRCm39) missense probably damaging 0.98
R7237:Kif20b UTSW 19 34,928,005 (GRCm39) missense probably damaging 1.00
R7260:Kif20b UTSW 19 34,927,610 (GRCm39) missense probably damaging 1.00
R7373:Kif20b UTSW 19 34,913,071 (GRCm39) missense probably damaging 1.00
R7418:Kif20b UTSW 19 34,907,087 (GRCm39) missense probably damaging 0.99
R7814:Kif20b UTSW 19 34,928,355 (GRCm39) missense possibly damaging 0.63
R7861:Kif20b UTSW 19 34,917,322 (GRCm39) missense probably damaging 1.00
R8017:Kif20b UTSW 19 34,917,279 (GRCm39) missense probably damaging 1.00
R8696:Kif20b UTSW 19 34,914,752 (GRCm39) missense probably benign 0.02
R8724:Kif20b UTSW 19 34,916,146 (GRCm39) unclassified probably benign
R8849:Kif20b UTSW 19 34,915,716 (GRCm39) nonsense probably null
R8947:Kif20b UTSW 19 34,918,629 (GRCm39) missense possibly damaging 0.46
R8998:Kif20b UTSW 19 34,914,253 (GRCm39) splice site probably benign
R9017:Kif20b UTSW 19 34,927,203 (GRCm39) missense probably benign 0.00
R9245:Kif20b UTSW 19 34,915,725 (GRCm39) missense probably benign 0.02
R9613:Kif20b UTSW 19 34,919,934 (GRCm39) missense possibly damaging 0.80
R9619:Kif20b UTSW 19 34,933,429 (GRCm39) missense probably damaging 1.00
R9732:Kif20b UTSW 19 34,930,353 (GRCm39) missense probably benign 0.18
R9746:Kif20b UTSW 19 34,928,149 (GRCm39) nonsense probably null
Z1088:Kif20b UTSW 19 34,927,851 (GRCm39) missense probably damaging 0.99
Z1176:Kif20b UTSW 19 34,930,275 (GRCm39) missense probably benign 0.11
Z1177:Kif20b UTSW 19 34,927,866 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGTTCAAGTACAGCTTGTAGCGG -3'
(R):5'- AACTAGCAATGAGTGCTTCAAGGGG -3'

Sequencing Primer
(F):5'- CCAGGATGTTACCTGCTACAAGG -3'
(R):5'- cctacaagttgttctttgactcc -3'
Posted On 2013-11-18