Mutagenetix > Incidental Mutation

Incidental Mutation 'R1069:Kif20b'

86144

Institutional Source

Beutler Lab

Gene Symbol

Kif20b

Ensembl Gene

ENSMUSG00000024795

Gene Name

kinesin family member 20B

Synonyms

Kif20b, Mphosph1, N-6 kinesin

MMRRC Submission

039155-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R1069 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34922361-34975745 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34950851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1131 (L1131P)

Ref Sequence

ENSEMBL: ENSMUSP00000153034 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223907] [ENSMUST00000223937]

AlphaFold

Q80WE4

Predicted Effect

probably damaging
Transcript: ENSMUST00000087341
AA Change: L1171P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795
AA Change: L1171P

Domain	Start	End	E-Value	Type
Blast:KISc	2	46	5e-15	BLAST
KISc	56	483	1.19e-103	SMART
low complexity region	521	551	N/A	INTRINSIC
coiled coil region	565	602	N/A	INTRINSIC
coiled coil region	705	746	N/A	INTRINSIC
coiled coil region	823	947	N/A	INTRINSIC
coiled coil region	1020	1325	N/A	INTRINSIC
coiled coil region	1348	1510	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000223907
AA Change: L1131P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000223937

Predicted Effect

probably benign
Transcript: ENSMUST00000224728

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	G	A	9: 41,590,298	R151H	possibly damaging	Het
4921524L21Rik	A	G	18: 6,624,037	N106S	probably benign	Het
Akr1c21	C	A	13: 4,575,334		probably benign	Het
Alpk2	G	A	18: 65,305,014	R1570C	probably benign	Het
Atp8b3	G	A	10: 80,531,018	R249C	probably damaging	Het
Cacnb4	C	A	2: 52,455,611	R252I	probably damaging	Het
Cars	T	C	7: 143,570,107	T480A	probably benign	Het
Ccnf	A	T	17: 24,223,997	C745*	probably null	Het
Ccr8	A	G	9: 120,094,217	I133V	probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Dgkq	T	C	5: 108,656,037		probably benign	Het
Ecd	A	G	14: 20,333,436	C312R	probably damaging	Het
Epp13	A	T	7: 6,255,922		probably null	Het
Gstm1	T	C	3: 108,012,748	S226G	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hacd4	T	A	4: 88,437,502	I49L	probably damaging	Het
Hid1	T	C	11: 115,356,765	N269S	probably damaging	Het
Ifitm3	A	T	7: 141,009,900		probably benign	Het
Kctd9	C	T	14: 67,729,420		probably benign	Het
Kif2c	T	C	4: 117,178,153	T33A	probably damaging	Het
Lipc	T	C	9: 70,823,537	T38A	probably benign	Het
Lrguk	A	C	6: 34,048,883	I205L	possibly damaging	Het
Ncapg	T	A	5: 45,675,930		probably benign	Het
Ptprd	A	G	4: 75,998,487		probably benign	Het
Ptprd	T	A	4: 76,100,633	K635*	probably null	Het
Sap130	G	A	18: 31,711,629	V898I	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Tas2r131	C	T	6: 132,957,825	R7K	probably benign	Het
Tfpi	A	G	2: 84,453,792		probably benign	Het
Trim80	T	C	11: 115,448,083	C580R	probably damaging	Het
Ttn	T	A	2: 76,969,929	I312F	unknown	Het

Other mutations in Kif20b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Kif20b	APN	19	34947660	missense	possibly damaging	0.77
IGL01021:Kif20b	APN	19	34938260	missense	possibly damaging	0.89
IGL01590:Kif20b	APN	19	34954726	missense	possibly damaging	0.87
IGL01691:Kif20b	APN	19	34935743	splice site	probably benign
IGL01730:Kif20b	APN	19	34950523	nonsense	probably null
IGL02078:Kif20b	APN	19	34935644	missense	probably damaging	1.00
IGL02174:Kif20b	APN	19	34934458	splice site	probably benign
IGL02536:Kif20b	APN	19	34974559	missense	probably benign	0.42
IGL03029:Kif20b	APN	19	34950913	missense	probably benign
IGL03186:Kif20b	APN	19	34934944	missense	probably benign	0.45
IGL03205:Kif20b	APN	19	34959463	missense	probably damaging	1.00
IGL03493:Kif20b	APN	19	34959550	nonsense	probably null
R0319:Kif20b	UTSW	19	34947732	splice site	probably benign
R1137:Kif20b	UTSW	19	34937086	critical splice donor site	probably null
R1255:Kif20b	UTSW	19	34950106	missense	probably benign	0.08
R1352:Kif20b	UTSW	19	34924635	missense	probably benign
R1466:Kif20b	UTSW	19	34950599	missense	probably benign	0.00
R1466:Kif20b	UTSW	19	34950599	missense	probably benign	0.00
R1473:Kif20b	UTSW	19	34974496	missense	possibly damaging	0.93
R1545:Kif20b	UTSW	19	34928918	missense	probably damaging	1.00
R1647:Kif20b	UTSW	19	34936790	missense	possibly damaging	0.65
R1648:Kif20b	UTSW	19	34936790	missense	possibly damaging	0.65
R1752:Kif20b	UTSW	19	34938336	missense	probably benign	0.13
R1835:Kif20b	UTSW	19	34956038	missense	probably damaging	1.00
R1889:Kif20b	UTSW	19	34941208	unclassified	probably benign
R1937:Kif20b	UTSW	19	34952878	missense	possibly damaging	0.73
R2112:Kif20b	UTSW	19	34931732	missense	probably benign	0.04
R2315:Kif20b	UTSW	19	34931599	missense	probably damaging	1.00
R2385:Kif20b	UTSW	19	34959419	missense	probably damaging	0.98
R2867:Kif20b	UTSW	19	34940128	missense	probably damaging	1.00
R2867:Kif20b	UTSW	19	34940128	missense	probably damaging	1.00
R3086:Kif20b	UTSW	19	34929715	missense	probably damaging	1.00
R3116:Kif20b	UTSW	19	34970080	missense	probably benign	0.38
R3407:Kif20b	UTSW	19	34950500	missense	probably damaging	1.00
R3834:Kif20b	UTSW	19	34935028	missense	probably damaging	1.00
R3882:Kif20b	UTSW	19	34950080	missense	probably damaging	1.00
R4698:Kif20b	UTSW	19	34951544	missense	probably damaging	1.00
R4721:Kif20b	UTSW	19	34938373	missense	probably benign	0.41
R4883:Kif20b	UTSW	19	34966122	missense	probably benign	0.00
R4901:Kif20b	UTSW	19	34934436	missense	probably benign	0.00
R4923:Kif20b	UTSW	19	34941211	critical splice acceptor site	probably null
R5538:Kif20b	UTSW	19	34952964	nonsense	probably null
R5540:Kif20b	UTSW	19	34938460	missense	probably benign	0.01
R5558:Kif20b	UTSW	19	34951549	missense	probably damaging	1.00
R5580:Kif20b	UTSW	19	34949728	splice site	probably null
R5934:Kif20b	UTSW	19	34941321	missense	probably benign	0.02
R6019:Kif20b	UTSW	19	34950464	missense	probably benign	0.00
R6464:Kif20b	UTSW	19	34934441	missense	probably benign
R6613:Kif20b	UTSW	19	34936984	nonsense	probably null
R6745:Kif20b	UTSW	19	34928876	missense	possibly damaging	0.94
R7097:Kif20b	UTSW	19	34974492	missense	probably damaging	0.98
R7237:Kif20b	UTSW	19	34950605	missense	probably damaging	1.00
R7260:Kif20b	UTSW	19	34950210	missense	probably damaging	1.00
R7373:Kif20b	UTSW	19	34935671	missense	probably damaging	1.00
R7418:Kif20b	UTSW	19	34929687	missense	probably damaging	0.99
R7814:Kif20b	UTSW	19	34950955	missense	possibly damaging	0.63
R7861:Kif20b	UTSW	19	34939922	missense	probably damaging	1.00
R8017:Kif20b	UTSW	19	34939879	missense	probably damaging	1.00
R8696:Kif20b	UTSW	19	34937352	missense	probably benign	0.02
R8724:Kif20b	UTSW	19	34938746	unclassified	probably benign
R8849:Kif20b	UTSW	19	34938316	nonsense	probably null
R8947:Kif20b	UTSW	19	34941229	missense	possibly damaging	0.46
R8998:Kif20b	UTSW	19	34936853	splice site	probably benign
R9017:Kif20b	UTSW	19	34949803	missense	probably benign	0.00
R9245:Kif20b	UTSW	19	34938325	missense	probably benign	0.02
R9613:Kif20b	UTSW	19	34942534	missense	possibly damaging	0.80
R9619:Kif20b	UTSW	19	34956029	missense	probably damaging	1.00
R9732:Kif20b	UTSW	19	34952953	missense	probably benign	0.18
R9746:Kif20b	UTSW	19	34950749	nonsense	probably null
Z1088:Kif20b	UTSW	19	34950451	missense	probably damaging	0.99
Z1176:Kif20b	UTSW	19	34952875	missense	probably benign	0.11
Z1177:Kif20b	UTSW	19	34950466	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGTGTTCAAGTACAGCTTGTAGCGG -3'
(R):5'- AACTAGCAATGAGTGCTTCAAGGGG -3'

Sequencing Primer
(F):5'- CCAGGATGTTACCTGCTACAAGG -3'
(R):5'- cctacaagttgttctttgactcc -3'

Posted On

2013-11-18