Incidental Mutation 'R1070:Ifi208'
ID86150
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173683044 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 255 (A255V)
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect probably damaging
Transcript: ENSMUST00000085876
AA Change: A255V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677
AA Change: A255V

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169857
AA Change: A255V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677
AA Change: A255V

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182880
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4342:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173683481 missense probably benign 0.08
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1339:Ifi208 UTSW 1 173683238 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173695570 critical splice acceptor site probably null
R3692:Ifi208 UTSW 1 173682872 missense possibly damaging 0.93
R4175:Ifi208 UTSW 1 173682701 missense probably benign 0.01
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173683023 missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173695654 nonsense probably null
R7972:Ifi208 UTSW 1 173678990 missense possibly damaging 0.68
R8143:Ifi208 UTSW 1 173682676 missense possibly damaging 0.91
R8383:Ifi208 UTSW 1 173683509 missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173683278 missense possibly damaging 0.85
RF027:Ifi208 UTSW 1 173677696 small deletion probably benign
RF029:Ifi208 UTSW 1 173677696 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTCCACCTGTGACAAATCTTCTCGG -3'
(R):5'- AAGGGCTGGATACTGTTGCTGC -3'

Sequencing Primer
(F):5'- GGTGCCTCCAGTGACAGTC -3'
(R):5'- TTGCAAGATCTGGACACTGC -3'
Posted On2013-11-18