Incidental Mutation 'R1070:Pcif1'
ID86152
Institutional Source Beutler Lab
Gene Symbol Pcif1
Ensembl Gene ENSMUSG00000039849
Gene NamePDX1 C-terminal inhibiting factor 1
Synonyms
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164879304-164894454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164889138 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 404 (Y404H)
Ref Sequence ENSEMBL: ENSMUSP00000039555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect probably benign
Transcript: ENSMUST00000041361
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
AA Change: Y404H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849
AA Change: Y404H

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130213
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Meta Mutation Damage Score 0.1348 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Pcif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Pcif1 APN 2 164885788 missense probably damaging 1.00
IGL01598:Pcif1 APN 2 164886611 missense possibly damaging 0.86
R0313:Pcif1 UTSW 2 164884419 missense probably damaging 0.97
R0329:Pcif1 UTSW 2 164889444 missense probably damaging 1.00
R0330:Pcif1 UTSW 2 164889444 missense probably damaging 1.00
R1350:Pcif1 UTSW 2 164886767 missense probably damaging 0.99
R1467:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1467:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1583:Pcif1 UTSW 2 164886727 missense probably damaging 1.00
R1640:Pcif1 UTSW 2 164885683 missense probably benign
R1852:Pcif1 UTSW 2 164888466 missense probably damaging 0.97
R2252:Pcif1 UTSW 2 164890879 missense probably benign 0.05
R2571:Pcif1 UTSW 2 164884211 missense probably damaging 1.00
R3879:Pcif1 UTSW 2 164885958 missense probably benign 0.40
R4956:Pcif1 UTSW 2 164889690 missense probably damaging 1.00
R5792:Pcif1 UTSW 2 164885379 missense probably damaging 0.97
R5913:Pcif1 UTSW 2 164884492 intron probably benign
R6798:Pcif1 UTSW 2 164885791 missense possibly damaging 0.94
R6913:Pcif1 UTSW 2 164884304 critical splice acceptor site probably null
R7359:Pcif1 UTSW 2 164884331 missense probably damaging 1.00
R7453:Pcif1 UTSW 2 164888364 missense probably damaging 1.00
R7453:Pcif1 UTSW 2 164889630 missense possibly damaging 0.94
R8031:Pcif1 UTSW 2 164886522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAAGGAGGCTACTTCACAGCG -3'
(R):5'- GGAACCTCTCAAAGGCAGAGTCATC -3'

Sequencing Primer
(F):5'- TGTTGATACAGGCCACCAG -3'
(R):5'- CTATAGCGGTAGAGGAGCCAC -3'
Posted On2013-11-18