Incidental Mutation 'R1070:Agtr1b'
ID86153
Institutional Source Beutler Lab
Gene Symbol Agtr1b
Ensembl Gene ENSMUSG00000054988
Gene Nameangiotensin II receptor, type 1b
SynonymsAgtr-1b, Angtr-1b, AT1B
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location20314473-20367177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20315748 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 231 (N231K)
Ref Sequence ENSEMBL: ENSMUSP00000128724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068316] [ENSMUST00000163776]
Predicted Effect probably benign
Transcript: ENSMUST00000068316
AA Change: N231K

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068298
Gene: ENSMUSG00000054988
AA Change: N231K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163776
AA Change: N231K

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128724
Gene: ENSMUSG00000054988
AA Change: N231K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 1.1e-65 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations are phenotypically normal, but homozygotes for the Agtr1b/Agtr1a double knockout exhibit reductions in growth, survival, blood pressure, and kidney size not found in either single knockout. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Agtr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01558:Agtr1b APN 3 20316260 missense probably damaging 0.99
IGL02706:Agtr1b APN 3 20315863 missense probably benign 0.01
IGL02958:Agtr1b APN 3 20316094 missense possibly damaging 0.91
IGL03243:Agtr1b APN 3 20315795 missense probably benign 0.13
R0125:Agtr1b UTSW 3 20315540 missense probably benign 0.00
R0565:Agtr1b UTSW 3 20315674 missense probably damaging 0.99
R0661:Agtr1b UTSW 3 20315999 missense possibly damaging 0.83
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1713:Agtr1b UTSW 3 20316309 missense probably benign 0.00
R4502:Agtr1b UTSW 3 20315798 missense probably damaging 1.00
R5613:Agtr1b UTSW 3 20316260 missense probably damaging 0.99
R6142:Agtr1b UTSW 3 20316394 missense probably benign 0.06
R6320:Agtr1b UTSW 3 20315779 missense probably benign 0.22
R6667:Agtr1b UTSW 3 20315749 missense possibly damaging 0.91
R6987:Agtr1b UTSW 3 20316421 missense probably benign 0.00
R7407:Agtr1b UTSW 3 20315731 missense possibly damaging 0.79
R7598:Agtr1b UTSW 3 20315913 missense possibly damaging 0.91
X0037:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0060:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20315506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTACGTCCGCAATTTCACAGTC -3'
(R):5'- CAATGCTGGTCGCCAAAGTCAC -3'

Sequencing Primer
(F):5'- TTCACAGTCATGGATGACGC -3'
(R):5'- ATCATCATCTGGCTGATGGC -3'
Posted On2013-11-18