Incidental Mutation 'R1070:Strip1'
ID86154
Institutional Source Beutler Lab
Gene Symbol Strip1
Ensembl Gene ENSMUSG00000014601
Gene Namestriatin interacting protein 1
Synonyms
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107612532-107631694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107627408 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 102 (E102G)
Ref Sequence ENSEMBL: ENSMUSP00000068587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064759] [ENSMUST00000106703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064759
AA Change: E102G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068587
Gene: ENSMUSG00000014601
AA Change: E102G

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
N1221 65 363 7.87e-138 SMART
low complexity region 376 394 N/A INTRINSIC
DUF3402 460 817 6.87e-202 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198424
Meta Mutation Damage Score 0.9161 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the striatin-interacting phosphatase and kinase complex, which is involved in localization of the Golgi body. The encoded protein participates in cytosketelal organization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, shortened anterior-posterior axis, cinching of tissue at the embryonic/extraembryonic boundary and abnormal mesoderm development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Strip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Strip1 APN 3 107621445 missense probably damaging 0.99
IGL01150:Strip1 APN 3 107626731 splice site probably null
IGL01484:Strip1 APN 3 107613259 missense probably damaging 0.99
IGL01862:Strip1 APN 3 107621882 missense probably damaging 0.99
IGL02425:Strip1 APN 3 107614646 missense probably benign 0.08
IGL02537:Strip1 APN 3 107616894 missense possibly damaging 0.94
IGL02948:Strip1 APN 3 107613266 missense probably benign 0.33
IGL03179:Strip1 APN 3 107620255 missense probably damaging 0.99
PIT4472001:Strip1 UTSW 3 107628170 missense probably benign 0.19
R0197:Strip1 UTSW 3 107614613 missense probably damaging 0.99
R0526:Strip1 UTSW 3 107620039 critical splice donor site probably null
R0543:Strip1 UTSW 3 107626775 missense possibly damaging 0.93
R0883:Strip1 UTSW 3 107614613 missense probably damaging 0.99
R1384:Strip1 UTSW 3 107626839 missense probably benign 0.00
R1467:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1467:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1772:Strip1 UTSW 3 107626731 splice site probably null
R2358:Strip1 UTSW 3 107615819 missense probably benign 0.01
R2484:Strip1 UTSW 3 107628221 missense possibly damaging 0.81
R2931:Strip1 UTSW 3 107625659 intron probably null
R3427:Strip1 UTSW 3 107616822 missense possibly damaging 0.68
R4584:Strip1 UTSW 3 107624503 missense probably benign 0.39
R4780:Strip1 UTSW 3 107626998 missense probably benign 0.01
R4853:Strip1 UTSW 3 107616916 missense possibly damaging 0.93
R5623:Strip1 UTSW 3 107626826 missense possibly damaging 0.69
R5801:Strip1 UTSW 3 107621441 missense possibly damaging 0.50
R6345:Strip1 UTSW 3 107628200 missense probably damaging 1.00
R6860:Strip1 UTSW 3 107618936 missense possibly damaging 0.50
R6869:Strip1 UTSW 3 107613445 missense probably damaging 1.00
R7022:Strip1 UTSW 3 107626795 missense probably benign 0.09
R7192:Strip1 UTSW 3 107615335 missense possibly damaging 0.94
R7387:Strip1 UTSW 3 107625730 missense probably damaging 0.99
R7631:Strip1 UTSW 3 107616931 missense possibly damaging 0.46
R8032:Strip1 UTSW 3 107618078 missense not run
Z1177:Strip1 UTSW 3 107615769 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTGCCATCAGAGTGCCCAGAAG -3'
(R):5'- CATTCCTCGGGACGTGACACTAAAG -3'

Sequencing Primer
(F):5'- GGCCCACTCTCCATGTCAAG -3'
(R):5'- TACAGCGCAGTTTGATGCAC -3'
Posted On2013-11-18