Incidental Mutation 'R1070:Kif5a'
ID 86171
Institutional Source Beutler Lab
Gene Symbol Kif5a
Ensembl Gene ENSMUSG00000074657
Gene Name kinesin family member 5A
Synonyms Khc, Kns, Kif5, D10Bwg0738e
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1070 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 127225696-127263348 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127245406 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 220 (T220A)
Ref Sequence ENSEMBL: ENSMUSP00000151402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895] [ENSMUST00000218298]
AlphaFold P33175
Predicted Effect probably benign
Transcript: ENSMUST00000099172
AA Change: T220A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: T220A

KISc 7 335 7.38e-173 SMART
low complexity region 340 362 N/A INTRINSIC
coiled coil region 408 539 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
coiled coil region 632 800 N/A INTRINSIC
coiled coil region 822 905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217895
AA Change: T220A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000218298
Meta Mutation Damage Score 0.1310 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Kif5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kif5a APN 10 127239196 missense probably benign
IGL01405:Kif5a APN 10 127245990 missense probably damaging 1.00
IGL01637:Kif5a APN 10 127245368 missense possibly damaging 0.94
IGL01894:Kif5a APN 10 127262779 missense probably benign 0.04
IGL01978:Kif5a APN 10 127245739 missense probably benign
IGL02039:Kif5a APN 10 127233867 missense possibly damaging 0.95
IGL02052:Kif5a APN 10 127243499 missense probably damaging 1.00
IGL02336:Kif5a APN 10 127242696 missense possibly damaging 0.87
IGL02352:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02359:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02834:Kif5a APN 10 127245756 missense probably benign 0.00
IGL03101:Kif5a APN 10 127235609 unclassified probably benign
brittany UTSW 10 127248254 missense probably damaging 1.00
spaniel UTSW 10 127230578 missense probably benign 0.00
R0463:Kif5a UTSW 10 127235652 missense probably benign 0.00
R0790:Kif5a UTSW 10 127246009 intron probably benign
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1502:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R1812:Kif5a UTSW 10 127242010 missense probably benign 0.03
R1837:Kif5a UTSW 10 127236815 nonsense probably null
R1838:Kif5a UTSW 10 127236815 nonsense probably null
R2012:Kif5a UTSW 10 127239175 missense probably benign
R2072:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2073:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2074:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2075:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2440:Kif5a UTSW 10 127231336 missense probably benign 0.34
R3157:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R3688:Kif5a UTSW 10 127242774 missense probably damaging 1.00
R3740:Kif5a UTSW 10 127243468 missense probably damaging 1.00
R4782:Kif5a UTSW 10 127230954 missense probably benign 0.01
R5049:Kif5a UTSW 10 127239839 missense possibly damaging 0.93
R5723:Kif5a UTSW 10 127231029 frame shift probably null
R5764:Kif5a UTSW 10 127231029 frame shift probably null
R5838:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R5903:Kif5a UTSW 10 127230578 missense probably benign 0.00
R6299:Kif5a UTSW 10 127233821 missense probably damaging 1.00
R6384:Kif5a UTSW 10 127242775 missense probably damaging 1.00
R6629:Kif5a UTSW 10 127248254 missense probably damaging 1.00
R7463:Kif5a UTSW 10 127243724 missense probably damaging 0.97
R7558:Kif5a UTSW 10 127248079 missense probably damaging 1.00
R7567:Kif5a UTSW 10 127237379 missense probably benign 0.00
R7733:Kif5a UTSW 10 127236740 missense probably benign 0.00
R7853:Kif5a UTSW 10 127235668 nonsense probably null
R7869:Kif5a UTSW 10 127243474 missense probably damaging 1.00
R7896:Kif5a UTSW 10 127242004 missense probably benign
R8085:Kif5a UTSW 10 127239309 missense probably benign 0.00
R8426:Kif5a UTSW 10 127231489 missense probably damaging 0.99
R8750:Kif5a UTSW 10 127248040 missense probably damaging 1.00
R9206:Kif5a UTSW 10 127243358 critical splice donor site probably null
R9497:Kif5a UTSW 10 127243484 missense probably damaging 1.00
Z1177:Kif5a UTSW 10 127229823 missense probably benign 0.00
Z1177:Kif5a UTSW 10 127236967 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttatctgtctgttcctcccaag -3'
Posted On 2013-11-18