Incidental Mutation 'R1070:Inhbe'
ID86172
Institutional Source Beutler Lab
Gene Symbol Inhbe
Ensembl Gene ENSMUSG00000047492
Gene Nameinhibin beta-E
Synonymsactivin, activin betaE
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127348857-127354411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127351513 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 11 (I11M)
Ref Sequence ENSEMBL: ENSMUSP00000053977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026472] [ENSMUST00000059718]
Predicted Effect probably benign
Transcript: ENSMUST00000026472
SMART Domains Protein: ENSMUSP00000026472
Gene: ENSMUSG00000025405

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TGFB 247 352 7.32e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059718
AA Change: I11M

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000053977
Gene: ENSMUSG00000047492
AA Change: I11M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
TGFB 247 350 3.63e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate an inhibin beta subunit. Inhibins have been implicated in regulating numerous cellular processes including cell proliferation, apoptosis, immune response and hormone secretion. This gene may be upregulated under conditions of endoplasmic reticulum stress, and this protein may inhibit cellular proliferation and growth in pancreas and liver. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null mutation are fertile with normal liver and reproductive morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Inhbe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02496:Inhbe APN 10 127350928 missense probably damaging 1.00
IGL02657:Inhbe APN 10 127350776 missense probably damaging 1.00
R1158:Inhbe UTSW 10 127351317 missense probably damaging 1.00
R2999:Inhbe UTSW 10 127351374 missense possibly damaging 0.84
R5396:Inhbe UTSW 10 127350601 missense possibly damaging 0.92
R7844:Inhbe UTSW 10 127350910 missense possibly damaging 0.55
R7927:Inhbe UTSW 10 127350910 missense possibly damaging 0.55
X0067:Inhbe UTSW 10 127350819 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACCCACCTATGATGGTAGCAAAGC -3'
(R):5'- ACCAGGCGATCTACTCTCAGTCTTC -3'

Sequencing Primer
(F):5'- GGTAGCAAAGCTGATGACTTTCTC -3'
(R):5'- TGACACTGGTTtgctgttgc -3'
Posted On2013-11-18