Incidental Mutation 'R1070:Rdh12'
ID86175
Institutional Source Beutler Lab
Gene Symbol Rdh12
Ensembl Gene ENSMUSG00000021123
Gene Nameretinol dehydrogenase 12
SynonymsA930033N07Rik
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location79208914-79222665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79213748 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 206 (L206P)
Ref Sequence ENSEMBL: ENSMUSP00000112543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021548] [ENSMUST00000122227] [ENSMUST00000140823]
Predicted Effect probably damaging
Transcript: ENSMUST00000021548
AA Change: L218P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021548
Gene: ENSMUSG00000021123
AA Change: L218P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:KR 40 209 7.4e-13 PFAM
Pfam:adh_short 40 243 1.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122227
AA Change: L206P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112543
Gene: ENSMUSG00000021123
AA Change: L206P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:KR 40 202 7.4e-9 PFAM
Pfam:adh_short 40 207 8.3e-16 PFAM
Pfam:Epimerase 42 227 2.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140823
SMART Domains Protein: ENSMUSP00000118851
Gene: ENSMUSG00000021123

DomainStartEndE-ValueType
Pfam:KR 28 130 3e-11 PFAM
Pfam:adh_short 28 137 2.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151980
Meta Mutation Damage Score 0.9640 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: The protein encoded by this gene is an NADPH-dependent retinal reductase whose highest activity is toward 9-cis and all-trans-retinol. The encoded enzyme also plays a role in the metabolism of short-chain aldehydes but does not exhibit steroid dehydrogenase activity. Defects in the human gene are associated with Leber congenital amaurosis type 13, and Retinitis Pigmentosa 53. [provided by RefSeq, Sep 2015]
PHENOTYPE: Deletion of this gene in mice results in slowed kinetics of all-trans-retinal reduction leading to delayed dark adaptation and increased susceptibility to light-induced photoreceptor apoptosis from accelerated 11-cis-retinal production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Rdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Rdh12 APN 12 79211402 missense probably benign 0.25
IGL02651:Rdh12 APN 12 79222052 missense probably damaging 1.00
IGL02828:Rdh12 APN 12 79218685 missense probably damaging 1.00
R1394:Rdh12 UTSW 12 79209065 missense probably benign
R1395:Rdh12 UTSW 12 79209065 missense probably benign
R1467:Rdh12 UTSW 12 79213748 missense probably damaging 1.00
R1467:Rdh12 UTSW 12 79213748 missense probably damaging 1.00
R1591:Rdh12 UTSW 12 79211504 missense probably damaging 1.00
R1633:Rdh12 UTSW 12 79218724 missense probably damaging 0.97
R3753:Rdh12 UTSW 12 79213672 nonsense probably null
R4117:Rdh12 UTSW 12 79213645 missense probably damaging 0.99
R5001:Rdh12 UTSW 12 79212742 missense probably damaging 1.00
R5509:Rdh12 UTSW 12 79210784 intron probably null
Predicted Primers PCR Primer
(F):5'- GTTCAGAAGTCCTGCCATTCGATCC -3'
(R):5'- TGTTCAACAGCCTGGTTCCAGAAG -3'

Sequencing Primer
(F):5'- CCTAGAGATGTTCTACCTGGAAG -3'
(R):5'- CCTATAATCTGGACCAAGGATTTCG -3'
Posted On2013-11-18