Incidental Mutation 'R1070:Heatr4'
ID86176
Institutional Source Beutler Lab
Gene Symbol Heatr4
Ensembl Gene ENSMUSG00000090843
Gene NameHEAT repeat containing 4
SynonymsGm17673
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83954499-83984852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83978067 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 327 (T327A)
Ref Sequence ENSEMBL: ENSMUSP00000129832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164935]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164935
AA Change: T327A

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843
AA Change: T327A

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Heatr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1225:Heatr4 UTSW 12 83978046 missense probably benign 0.01
R1398:Heatr4 UTSW 12 83967621 missense possibly damaging 0.45
R1467:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1467:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1626:Heatr4 UTSW 12 83973721 missense probably benign 0.00
R1728:Heatr4 UTSW 12 83967572 missense probably benign 0.03
R1779:Heatr4 UTSW 12 83980160 missense probably benign 0.30
R1784:Heatr4 UTSW 12 83967572 missense probably benign 0.03
R1860:Heatr4 UTSW 12 83979728 nonsense probably null
R1903:Heatr4 UTSW 12 83958447 missense probably damaging 1.00
R1916:Heatr4 UTSW 12 83955817 missense probably benign 0.21
R1972:Heatr4 UTSW 12 83955020 missense probably damaging 1.00
R2008:Heatr4 UTSW 12 83979740 missense probably benign 0.01
R2081:Heatr4 UTSW 12 83980322 missense probably damaging 0.99
R2093:Heatr4 UTSW 12 83975081 missense possibly damaging 0.63
R2399:Heatr4 UTSW 12 83980333 missense probably benign 0.00
R2680:Heatr4 UTSW 12 83980463 missense possibly damaging 0.91
R4618:Heatr4 UTSW 12 83978067 missense probably damaging 1.00
R6400:Heatr4 UTSW 12 83955010 missense probably null 1.00
R6527:Heatr4 UTSW 12 83979763 missense probably damaging 1.00
R6616:Heatr4 UTSW 12 83980130 missense probably benign
R6815:Heatr4 UTSW 12 83979727 missense probably damaging 0.96
R7070:Heatr4 UTSW 12 83969858 missense probably benign
R7219:Heatr4 UTSW 12 83957870 missense possibly damaging 0.89
R7329:Heatr4 UTSW 12 83978082 missense probably benign 0.00
R7477:Heatr4 UTSW 12 83979830 missense probably damaging 0.97
R7570:Heatr4 UTSW 12 83979644 missense probably benign 0.10
R7709:Heatr4 UTSW 12 83957725 missense probably damaging 0.98
Z1177:Heatr4 UTSW 12 83980478 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGCTATTCTTGTCCCAAGATGCCC -3'
(R):5'- AGGTTCTCCCAGTGGCTCCATATTC -3'

Sequencing Primer
(F):5'- AAGATGCCCTCGTTTCCTCAG -3'
(R):5'- GGCTCCATATTCAGATGGCAC -3'
Posted On2013-11-18