Incidental Mutation 'R1070:Mylk4'
ID86178
Institutional Source Beutler Lab
Gene Symbol Mylk4
Ensembl Gene ENSMUSG00000044951
Gene Namemyosin light chain kinase family, member 4
SynonymsEG238564
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location32700834-32783954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32724818 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 333 (D333G)
Ref Sequence ENSEMBL: ENSMUSP00000155702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057428] [ENSMUST00000230119]
Predicted Effect probably benign
Transcript: ENSMUST00000057428
AA Change: D102G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060149
Gene: ENSMUSG00000044951
AA Change: D102G

DomainStartEndE-ValueType
S_TKc 107 362 4.2e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134352
AA Change: D102G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116013
Gene: ENSMUSG00000044951
AA Change: D102G

DomainStartEndE-ValueType
S_TKc 107 361 1.01e-83 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229922
Predicted Effect probably benign
Transcript: ENSMUST00000230119
AA Change: D333G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Mylk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Mylk4 APN 13 32715922 missense probably damaging 1.00
IGL01799:Mylk4 APN 13 32781691 missense probably benign 0.00
IGL01985:Mylk4 APN 13 32717581 missense possibly damaging 0.81
IGL02105:Mylk4 APN 13 32720562 missense probably benign 0.17
IGL02270:Mylk4 APN 13 32729066 splice site probably benign
IGL02377:Mylk4 APN 13 32722147 missense possibly damaging 0.69
IGL03142:Mylk4 APN 13 32720599 missense probably damaging 1.00
R0550:Mylk4 UTSW 13 32716666 missense probably benign 0.00
R0599:Mylk4 UTSW 13 32712754 unclassified probably null
R1520:Mylk4 UTSW 13 32712838 unclassified probably null
R1658:Mylk4 UTSW 13 32712789 missense possibly damaging 0.77
R1917:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R1918:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R1919:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R2187:Mylk4 UTSW 13 32722013 missense probably damaging 0.97
R2568:Mylk4 UTSW 13 32722018 missense probably null 0.97
R4832:Mylk4 UTSW 13 32721977 missense probably benign 0.04
R5268:Mylk4 UTSW 13 32708881 unclassified probably null
R6801:Mylk4 UTSW 13 32728410 missense probably benign 0.07
R6894:Mylk4 UTSW 13 32722015 missense probably damaging 1.00
R7302:Mylk4 UTSW 13 32720565 missense probably benign 0.39
R7329:Mylk4 UTSW 13 32716783 missense probably damaging 1.00
R7634:Mylk4 UTSW 13 32708908 missense possibly damaging 0.88
R7702:Mylk4 UTSW 13 32720602 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTGCTAACCCTGGCTTTAGACAG -3'
(R):5'- TGCCTTGGAACTTCAGATTTCTCGC -3'

Sequencing Primer
(F):5'- ATGCCAACCTTATGGGACTG -3'
(R):5'- ATGTGACCCCAAAGAGTTTGTG -3'
Posted On2013-11-18