Mutagenetix > Incidental Mutation

Incidental Mutation 'R1071:Bub1b'

86187

Institutional Source

Beutler Lab

Gene Symbol

Bub1b

Ensembl Gene

ENSMUSG00000040084

Gene Name

BUB1B, mitotic checkpoint serine/threonine kinase

Synonyms

BUBR1

MMRRC Submission

039157-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1071 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

118428692-118472072 bp(+) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

CAT to C at 118462928 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000037126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038341]

AlphaFold

Q9Z1S0

Predicted Effect

probably null
Transcript: ENSMUST00000038341

SMART Domains

Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084

Domain	Start	End	E-Value	Type
PDB:4GGD\|D	14	35	6e-6	PDB
Mad3_BUB1_I	49	173	1.83e-68	SMART
low complexity region	198	214	N/A	INTRINSIC
low complexity region	382	395	N/A	INTRINSIC
coiled coil region	418	457	N/A	INTRINSIC
low complexity region	671	686	N/A	INTRINSIC
low complexity region	717	726	N/A	INTRINSIC
Pfam:Pkinase	806	942	4.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126013

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130512

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc2	T	C	10: 80,147,336 (GRCm39)	S768P	probably damaging	Het
Cplane1	T	A	15: 8,247,910 (GRCm39)	H1486Q	probably benign	Het
Eml4	G	T	17: 83,785,468 (GRCm39)	E878*	probably null	Het
Plcb1	A	G	2: 135,167,577 (GRCm39)	D457G	possibly damaging	Het
Prepl	T	C	17: 85,377,940 (GRCm39)	Y480C	probably damaging	Het
Senp6	T	A	9: 80,044,011 (GRCm39)	Y708N	probably benign	Het
Ugt2b38	T	G	5: 87,560,232 (GRCm39)	N361H	probably damaging	Het
Ugt3a1	T	C	15: 9,367,454 (GRCm39)	V399A	possibly damaging	Het
Vmn1r30	A	T	6: 58,412,813 (GRCm39)	N6K	possibly damaging	Het
Vmn2r3	G	A	3: 64,182,697 (GRCm39)	T334I	possibly damaging	Het
Vtn	C	A	11: 78,392,602 (GRCm39)	N393K	probably benign	Het
Zfp786	T	C	6: 47,798,239 (GRCm39)	D233G	possibly damaging	Het
Zmym2	A	G	14: 57,197,278 (GRCm39)	T1349A	possibly damaging	Het

Other mutations in Bub1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Bub1b	APN	2	118,460,619 (GRCm39)	missense	probably benign
IGL01319:Bub1b	APN	2	118,445,475 (GRCm39)	missense	possibly damaging	0.49
IGL01744:Bub1b	APN	2	118,467,230 (GRCm39)	missense	probably damaging	0.99
IGL03184:Bub1b	APN	2	118,440,258 (GRCm39)	splice site	probably benign
P0035:Bub1b	UTSW	2	118,452,666 (GRCm39)	missense	probably damaging	1.00
R0315:Bub1b	UTSW	2	118,457,457 (GRCm39)	splice site	probably benign
R0322:Bub1b	UTSW	2	118,470,099 (GRCm39)	splice site	probably benign
R0378:Bub1b	UTSW	2	118,471,604 (GRCm39)	missense	probably benign	0.01
R0457:Bub1b	UTSW	2	118,440,340 (GRCm39)	missense	probably damaging	1.00
R0845:Bub1b	UTSW	2	118,440,457 (GRCm39)	missense	probably damaging	1.00
R0960:Bub1b	UTSW	2	118,437,161 (GRCm39)	missense	probably benign	0.03
R1129:Bub1b	UTSW	2	118,445,487 (GRCm39)	missense	probably damaging	1.00
R1138:Bub1b	UTSW	2	118,453,570 (GRCm39)	missense	probably benign	0.01
R1171:Bub1b	UTSW	2	118,437,167 (GRCm39)	missense	probably benign	0.31
R1613:Bub1b	UTSW	2	118,470,222 (GRCm39)	critical splice donor site	probably null
R1667:Bub1b	UTSW	2	118,471,670 (GRCm39)	missense	probably benign	0.00
R1812:Bub1b	UTSW	2	118,462,902 (GRCm39)	missense	probably benign	0.00
R1828:Bub1b	UTSW	2	118,468,920 (GRCm39)	missense	probably benign	0.00
R2085:Bub1b	UTSW	2	118,452,676 (GRCm39)	missense	possibly damaging	0.88
R2137:Bub1b	UTSW	2	118,467,199 (GRCm39)	nonsense	probably null
R3749:Bub1b	UTSW	2	118,445,936 (GRCm39)	missense	possibly damaging	0.63
R3750:Bub1b	UTSW	2	118,445,936 (GRCm39)	missense	possibly damaging	0.63
R4211:Bub1b	UTSW	2	118,461,459 (GRCm39)	missense	possibly damaging	0.78
R4579:Bub1b	UTSW	2	118,453,657 (GRCm39)	nonsense	probably null
R4993:Bub1b	UTSW	2	118,467,251 (GRCm39)	missense	possibly damaging	0.63
R5144:Bub1b	UTSW	2	118,445,980 (GRCm39)	missense	possibly damaging	0.92
R5229:Bub1b	UTSW	2	118,460,470 (GRCm39)	missense	probably damaging	1.00
R5596:Bub1b	UTSW	2	118,461,463 (GRCm39)	missense	probably damaging	1.00
R5656:Bub1b	UTSW	2	118,435,912 (GRCm39)	missense	probably damaging	1.00
R5785:Bub1b	UTSW	2	118,440,325 (GRCm39)	missense	probably damaging	0.98
R5883:Bub1b	UTSW	2	118,440,363 (GRCm39)	missense	probably damaging	1.00
R6128:Bub1b	UTSW	2	118,448,293 (GRCm39)	missense	probably benign
R6187:Bub1b	UTSW	2	118,461,481 (GRCm39)	missense	probably damaging	1.00
R6333:Bub1b	UTSW	2	118,428,944 (GRCm39)	critical splice donor site	probably null
R6985:Bub1b	UTSW	2	118,437,095 (GRCm39)	missense	probably damaging	1.00
R6988:Bub1b	UTSW	2	118,467,311 (GRCm39)	missense	probably damaging	0.96
R7161:Bub1b	UTSW	2	118,456,534 (GRCm39)	missense	probably damaging	1.00
R7341:Bub1b	UTSW	2	118,467,267 (GRCm39)	missense	possibly damaging	0.95
R7575:Bub1b	UTSW	2	118,471,639 (GRCm39)	missense	possibly damaging	0.51
R7824:Bub1b	UTSW	2	118,457,448 (GRCm39)	splice site	probably null
R8129:Bub1b	UTSW	2	118,468,975 (GRCm39)	missense	probably benign	0.06
R8702:Bub1b	UTSW	2	118,468,975 (GRCm39)	missense	probably benign	0.06
R8787:Bub1b	UTSW	2	118,462,305 (GRCm39)	missense	probably damaging	1.00
R9569:Bub1b	UTSW	2	118,468,884 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGCCCTTGAACACTAAGTGCTC -3'
(R):5'- TCTTGCCCTAGAACGGTGACTGAC -3'

Sequencing Primer
(F):5'- tgctaagtcctcttaactgcc -3'
(R):5'- CCTAGAACGGTGACTGACTTTTTG -3'

Posted On

2013-11-18